martes, 22 de junio de 2010

Erklaren/Verstehen/Festejen uruguayos no má!!!!!!!



Uruguayos festejando el triunfo futbolísitco ante México.


¿¡Cómo les va queridos niños y amas de casa!?
A los hombres de la casa (Dado que como corresponde, todo hogar debe contar con una mamá un papá y los niños, siendo el que dirige y organiza a toda la fmailia quien porta el pene, como otrora quien portaba la espada y ahora el que tiene el celular más caro de la tribu urbana) ni les pregunto... Por que no están... porque están...
¡Jajajaja! Sí... ¡Qué alegría para todos! Están festejando lo más parecido a ser una potencia colonial como España, ganarles el virreinato a los bonaerenses o que los franceses reconozcan que Gardel nació en Tacuarembó... ¡Sí hoy es un día de gran algarabía patoteril... perdón patrioteril, dado que nuestra pequeña Suiza de América y ahora país bananero... socialista (para mí estábamos mejor con los milicos)ha clasificado para el mundial de fulbo en sudafricaca... ¡Y mirá vo! En un país esótico clasificó, no acá no más... sabés lo que debe ser andar ahí en el medio de sudáfrica con todos los negros esos, chorros que te roban a tus hijos para violarlos y comerselos alrededor tuyo, bailando el guaca guaca como Shakira y Juan Carlos Priscione...
Sí, no saludo a los esposos, ya que stán festejando el partido que hoy Uruguay le ganó a México, por lo cual





1)No pasaron los ómnibus.
2)No se podía preguntar a quién estuviera en la parada por qué no pasban los ómnibus sin que te miraran con cara de "¡Antipatriota te denunciaré!" y te dijeran: "¡Ah, es por que está jugando Uruguay con México y viene ganando..." y luego pusieran una gran sonrisa de felicidad y vos te preguntes de qué te tendráis que alegrar de que no pase el ómnibus.
3)En la tele te mostraban super contentos y orgullosos, como en ciertos liceos en vez de dar clases (a estos chiquilines de ahora, que no saben ni leer ni escribir y son unos maleducados peoncitos del sistema, ignorantes, consumistas y sin pensamiento propio, sobrevalorados por repetir unas consginas seudo-progresistas como no lo hacían las generaciones anteriores por repetir eslóganes igual de fachos pero de corte paisito burgués), les hacían mirar el pertido junto a Alex Mazzei y otros hijos de putas mantenidos con nuestros impuestos, y gritar y saltar con banderas pintarrajeadas en a cara como unos monos. Sólo les faltaba decir "Hail Pepe" y ya estaba.
4)Jorge "Pollito" Manco tuviera que bancarse la cara de culo de todo el mundo por tener el descaro de decir que el fútbol no le gusta ni le interesa.
5) Que en blogs seudo-intelectuales de gente que se dice anarquista, después de poner un posts super crítico hacia el mundial, pusieran igual posts sobre fútbol, porque "la mayoría de los seguidores son de Argentina y bue, los Argentinos ganaron un partido y viste... hay que hacerles algún mimito demagógico a las personas en el clítoris chauvinista.."
6)Que si vas a pedir una pizza en el Bar Manchester (cito en Convención y 18) pero estás sin mirar el partido, te digan que no tienen y no pidas por un rato, mientras a a las otras mesas de borrachos cavernícolas que gritan como nazis patoteros les sirvan en tu cara.
Por lo cual, si Ud. es un antipatriota de mierda como J. "Pollito " Manco o Talthec y se asombra y trata de razonar con la gente cuando te dicen tan sueltas de cuerpo que por ejemplo no te van a prestar un servicio público indispensable, o no vas a trabajar después de haber llegado en hora porque "Hay partido", Ud. debe saber:
1) Mirar el partido y alentar a las nuevas generaciones en el fanatismo irracional, el maniquismo y la incuestionalbilidad de las costumbres racionales más rancias, también es educación. Después sale dieciendo "la religión es el opio de lso pueblos2 y ya alcanza para que nadie diga que esun fanático irracional y mongólico.
2)Si no te gusta el fúlbo, igual tenés que mirar losprartidos , alegrarte y andar todo eufórico pro la calle porque "Es la celeste".
3)Hay que ser patriota.
4)Si preguntás "¿Qué es ser patriota?" y no te alcanza la respuesta: "Apoyar a la celeste, porque todos están contentos, porque gana Uruguay", como si los tres millones de habitantes hubiesen estado en el estadio corriendo atrás de una pelota como unos pelotudos, es porque "Estás loco","Te hacés el rarito", "Sos puto",etc.
5) Si preguntás porque habrías de ser patriota, vas a ser insultado.
6) "Hay que apoyar a la celeste, porque hoy todos los Uruguayos están unidos, no es como otros días de fulbo, en que los de Nacional y Peñarol, como son enemigos, se insultan y llegan a lastimarse, hoy todos son amigos en el Uruguay y todos nos tenemos que sentir identificados con el triunfo de la selesión".
9807654,5)La manga de navos patasucias que corren como unos giles atrás de una bola hecha con cachos de vaca muerta deshollada con un trapo celeste por arriba de sus torsos peludos de cavernícolas son semidioses que luchan por la honra de nuestra nación y deben ser admirados como en la antigua Grecia se admiraba a Héctor, Menelao y Heracles.





Uruguayo escuchándote explicarle por qué no te gusta el fútbol.


Así que para todos los no comunistas-antipatriotas-gueys que nos están mirando aún, un gran abrazo y festejemos... ¡¡¡Festejen uruguayos!!! aprovechen ahora antes de que los caguen a puñaladas afuera del estadio por ser de otro cuadro (lo cual está bien, porque el fubol es un sentimiento y deporte de hombres)y abracen el sobaco mugriento de su hermnao uruguayo que grita babenado cerveza: "¡Vamo, vamo Uruguay no má!", agitando el cáncer producido por la contaminación provocada por una de las empresas que patrocina el mundial y llegue a su casa de resaca directo a pegarle a su esposa e hijos porque no le dejan escuchar el partido...
Festeje y no s eprecocupe por la comida; hoy doña Pocha e da una receta muy fácil para la cena:


Hamburguesas de diez pesos para festejar el mundial:


Ingredientes:
-Una Tele con Cable.
-Hamburguesas de diez pesos.
-Una bandera de Uruguay colgada en la puerta de su casa (los demás son enemigos, si viene la peste y ve esa bandera sigue de largo, matando a los Argentinos y otros que no importan).
-La familia unida por el fubol.
-Una maza de picar concreto.


Después de ir al almacén y compar las hamburguesas (fíjese que sea de las que tienen bastante grasas y no alimentan un carajo), quédese conversando sobre el partido como si fuera lo único que le importara en la vida. Llegue a su casa. Cuelgue la bandera de forma que no se vea para adentro de las ventanas. Prenda la tele. mientras sus hijos estén distraídos viendo a Sahkira vistiendo una falda de paja y diciendo "guacaguacaguacaguacaguaca" mientras tiene movimientos espásmicos, agarrelos a martillazos (cerciórese de que hayan estado lo suficientemente expuestos a a la educación o la tele antes de esto). Con la mierdra que bortara abundantemente del cráneo de lso niños/adolescentes, embadurne las hamburguesas después de haberlas freído.
Siéntee a ver el partido comiendo las hamburguesas a la mierda sin que nadie moleste, chupándose de mientras un caballito blanco. No se queme por los milicos, porque como hay partido, para no moverse de en frente a ala tele no van a ir a su casa por más que los vecinos denuncien que mató a sus hijos.
¡Hasta la próxima semana! Y... ¡Vamo arriba uruguay no má!

20 comentarios:

  1. y esta todo bien con que no te guste el fútbol, no por eso todos los demás son unos mongólicos.

    Yo mire el partido en el laburo y la verdad que me quede contento con la victoria de Uruguay.

    Yo no soy muy futbolero tampoco, pero siempre fui muy por los mundiales.

    Yo tampoco estoy de acuerdo con que el transporte disminuya o desaparezca, pero que a vos no te guste el fútbol no te hace superior a los demás.

    No se si esto que pusiste es jodiendo o no, pero ta jaja

    ResponderEliminar
  2. Esta perfecto que te guste el futbol jave. La cuestión del post es que justamente la gente a la que le gusta no acepta que a nosotros no nos guste, y nos parece aberrante que en el liceo nos digan que no se dictan clases x el partido y q intenten justificarlo como un momento de patriotismo, cuando en realidad no veo que se pare el pais x el tenis ,ni por el basketball,ni por cosas que deberian ser mas importantes y que no son deportes.
    No es tema de creerse superiores a nadie sino de expresar nuesta opinion de que la gente se estupidiza de tal manera con el futbol que el mundo se puede venir abajo que si hay partido te dejan morir igual. Si no me crees intenta llamar un medico un dia de partido. La anécdota de la pizza es real, no nos daban pizza xq las q taban haciendo en el bar eran pa los q taban mirando el futbol, y nosotros sentados como unos panchos.
    Otra cosa, xq si a mi no me gusta el futbol lo tengo q ver igual si voy a un bar?xq no hacen un sector para ver el partido y otro pa los q no kieran?
    La gente me trata de poco hombre, antipatriota, raro,etc, solo xq no me gusta lo mismo q a la mayoria.
    Pa dejarlo mas claro: Si yo hago un post diciendo q la cumbia les da malos valores a los pibes, los vuelve machistas, les promueve robar,drogarse y hablar mal, y salta alguien a decirme q xq a mi no me guste no significa q yo sea superior ni q los dmas sean mongolicos,vos q dirias?
    Es sentirse superior querer tomar un omnibus?No entendi.

    ResponderEliminar
  3. ta no se puede discutir... yo nunca voy a tener razón para ustedes igual por lo que veo.

    yo no creo que todos sean unos monos pinturrajeados, pero bueno. A mi no me paso nada de eso que dicen ustedes, lamentablemente este es un país fanático por el fútbol, que le van a hacer? A mi de chico me hubiera gustado haber vivido esto que se esta viviendo, pero como hemos hablado cada uno tiene sus puntos de vista y sus experiencias.

    para cuando crean el post dandole palo a la cumbia plancha? jaja

    ResponderEliminar
  4. Este comentario ha sido eliminado por el autor.

    ResponderEliminar
  5. Quien los trato de poco hombres??? eso es cualquiera, pero es por que la persona esa es cualquiera, no todos piensan así bo. yo no le doy mucha bola al fútbol y a mi nadie nunca me dijo nada.

    En fin, seré un mono entonces

    ResponderEliminar
  6. PD: perdón por tantos posts jaja

    Pero para mi lo de la cumbia y los valores no tiene nada que ver con esto, para mi al menos

    ResponderEliminar
  7. aunque no sé por qué me preguntás cosas que dijo Doña Pocha, como ella se niega a contestar comentarios, te voya responder yo.
    Disculpá que demoré en contestarte, es que estos dís estuve en cualquiera y no justamente por mirar el partido ni sus nefastas consecuencias; de todas maneras veo que el seba te contesto algunas cosas que yo también podría haberte dicho.
    como sabrás, aunque haga un personaje de anormal enfermo de la cabeza muchas veces, soy una persona bastante racional (incluso demasiado a veces) y está fuera de todo racionalismo, e incluso de mi ideología personal sentirme superior a nadie, primero que nada. Eso es lo primero que quiero aclarar para que más o menso veas que no dejé de ser la misma persona que fui siempre y no me convertí en un metalero neonazi ni nada.
    Segundamente, no creo que sean mongólicos todos lso que gustan del fútbol regular o esporádicamente, sólo pienso que son unos reverendos mongólicos manipulados los que tienen las actitudes detalladas en el post: tratarme a mi de mongólico, puto (sí, esto me lo han dicho varias personas en la cara y al seba también veo)y varias cosas más por no gustarme el fútbol, como si fuera una obligación. Sobre todo me molesta de sobre manera que dentro de gente que se supone que tndría que te ner una mayor capacidad de razonmaiento y cuestionamiento e incluso entre quienes se creen o dicen "progresistas", haya reacciones tan violentas y fachas, como (sin ir más lejos) que hoy e encontrara con uan ex-compañera del I.P.A y actual docente de literatura e inglés en el bondi y cuando e empezó a habalr de fútbol yo le dijera que no me guustaba y que no sabía nada, y ésta me contestara: "ah, epro entonces estás en contra de la mayoría de lso uruguayos". Te juro que es textual. Lo que me embroma es esa manipulación y ese autosometimiento vinculado al fútbol: deporte como elemento de noramlización, segregación, reactivación de valores históricamente negativos omo el nacionalismo exacerbado, el patrioterismo, la pasividad, la euforia colectiva, etc. Y eso a nivel de loq ue es la gente y sus actitudes, si vos te ponés a escarbar loq ue hay detrás de todo ese negocio del fútbol, ni te cuento. Basta con que revises a nivel de este miserable paisito, las viejas noticias acerca de la mafia de paco casal y tenfield, noticias que se silenciaron muy a tiempo.

    ResponderEliminar
  8. básicamente el post se trataba de eso. como preguntaste bien y no agresivamente o acusando como suele hacer la gente que critico, no, no pienso que seas un mongólico no. Ypodés discutir con nosotros todo lo que quieras paja.
    lo del mono además es otra cosa,que tiene que ver con la función performativa del lenguaje y a pragmática. O sea, la reacción que se genera con el texto, que no siempre es una expresión directamente genuina o legítima de la verdad del ser que se expresa. Dicho en otras palabras, como recordarás, desde que hacíamos el fanzine "Culturra" nuestra intención es hacer cosas entre la joda y la rabia, que molesten a los mongos que s epuedan sentir tocados,y sean entendiadas por queines tengasn un mínimo sentido del humor y autocritica. El mono y otras cosas, son puramente y aderede para hacer calentar. No creo que ninguno de lso futboleros que critico sean monos, ya qu elos monos se merecen todo mi respeto, ya que como animales que son, son seres íntegros y perfectos.
    Quedará a tu criterio considerar si el artículo es en joda o no.
    Y en serio, lo dicho en el post es todo real, nos pasó lo de las pizzas (y ago más bizarro aún en ese bar que va en el próximo post) que nos trataran de putos, de raitos y ahora también que vos nos cuestionaras si nos creeemos superiores, que de últiam no es tan grave ni ofensivo, pero si extraño ya que nos conocés y en el post se dice clarito que nos estamso refiriendo a mongólicos del orto y no a vos mirando el partido re contento y trankilo. Incluso, no sé si recordás que el año pasado cuando me pegaron un tiro en casa, la policía vino al otro día, em querían detener a mí mismo y encima me decían re cagándose de la risa que no habían venido porque estaban viendo el partido. Si pasarán cosas absurdas alrededor del fútbol.
    lo de la cumbia y lso valores viene por eso, porque le hecho de que critiquemos cosas de las que nos sentimos por fuera noq ueire decir que nos creamos superiores a ndie, si no pensá cuantas críticas sobre la música qu enos gusta, sobre nuestra propia profesión y sorbe nosotros mismos hay en todos lso posts. si yo me sintiera superior a mi mismo al criticarme tendría un grave porblema de desdoblamiento de personalidad.
    y la receta final e suna matáfora javito, de lo que las "generaciones aptas para la vida social" le sestán haciendo a las nuevas generaciones con su concepto de mierda de la educación y de encerrarse a ver el partido en vez de hacer la tarea que corresponde -por ejemplo- aun adscripto y otras cosas que veo a diario y que encima te lo justifiquen con la ecusa bien a lo vago chanta uruguayo: "enseñarles a seguir a la celeste es también educación". pa eso se queda en la casa tanto el niño como el adulto y el adulto se banca que le descuenten el día ¿No?
    No te quemes por hacer muchos post, peor es hacer uno sólo tan largo como yo.
    un abrazo valor y lo de la cumbia plancha quizás pueda ser un artículo colaboración entre vos y tu hermano... no?

    ResponderEliminar
  9. ehhhhh uuhhhhhhhhhhh buuuuuuuuuuuu aaaaaaaaaaaaaah
    vamo arriba la celesta!
    juaaaaaaaaaaaaaaaaaas
    me gusta este blog
    me gusta el fulbo
    me gustan las personas que no gustan del fulbo
    me gusta la verdad
    no leí todos los comentarios porque se hizo medio largo
    me gusta ver a la gente boludeando en la calle
    al menos por un partido
    sería bueno que festejasen por otras cosas también
    queselevasé
    eeeh
    uuuuuuuuuuuuh
    veeeeeeeeeeeeeeee(una oveja)

    ResponderEliminar
  10. jajaja capaz que mal interprete cosas por tantos insultos de por medio.

    Pero para mi esta bueno que la gente se olvide un poco de sus problemas por algo como el deporte (deporte rey en nuestro país)
    Por lo menos no es igual a cuando juega nacional y peñarol que se mandan cualquiera en el bondi y eso. Lo que veo es que la gente festeja junta sin importar raza, religión ni política, eso me parece bueno, al menos a mi.

    Para mi en cuanto a la mafia del fútbol, no me pongo a pensar en eso, es un simple partido de fútbol que nos da alegría por uno momento.

    Lo de la cumbia dije que nada que ver, por que la cumbia villera a mi almenos es algo que me molesta todos los días (siempre el flaco con el cel en el bondi y los pendejos hablando como carcelarios jaja) esto de Uruguay hace 40 años que no se daba y me parece que es razonable que la gente este así, el fútbol acá es como el mate y las tortas fritas, es así queramos o no, hay que ser un poco tolerante en ese sentido.

    Seba me decía hoy que no podía desayunar por que la almacén estaba cerrada hasta que el partido terminara, sin embargo acá cerca de mi casa todas las almacenes estaban abiertas, es cuestión de mala suerte no se jaja.

    Yo creo que no entendi que todo eso que escribiste Jorge era haciendo un personaje, vi tanto "cavernicola, monos, mongos, nazis" que ta.

    No puedo creer que los insultaran por que no les gusta el fútbol, ustedes tenían cara de culo en el bar? jajaja no veo otra razón para esas cosas, o que la gente que comía pizza haya reservado el lugar en el bar con anticipación, no se.

    Y ahora Uruguay paso a los 4tos de final, como dije desde México 70 no pasaba eso y desde 1954 que no se ganaban 3 partidos consecutivos en un mundial, vamo arriba Uruguay! jajaja

    (soy un nazi por decir eso?)

    ResponderEliminar
  11. Javier:(¿xq no pondran un boton pa responderle directo a la persona en los blogs?)Esta es la sección de Doña Pocha y todo lo que se escriba en esta sección es referente a ella y su opinion del mundo.
    Otra cosa a destacar, es el nombre del blog que estan leyendo. Trasluce una actitud agresiva de por si y hace referencia a que es un espacio en donde se expresarán pensamientos, ideas, sentimientos y obras que no gustarán a todo el mundo(entendemos que para leer y/o ver cosas más populares hay otros blogs y espacios).
    De todas formas no quiero que piensen que censuramos su pensamiento y expresión del mismo como pensaron otras personas antes, sino hubieramos borrado los comentarios. Nos parece genial que comenten su opinión y fomentamos lo sigan haciendo.
    Respondiendo a tu ultimo comentario, me parece bueno que la gente se olvide un poco de los problemas enfocandose en algo divertido,sino explotariamos todos del stress. Lo que me molesta es que se utilice ese medio de distracción como herramienta para que la gente no se de cuenta de que políticamente la cagan por todos lados. Es el viejo "pan y circo" con el agregado de que ahora le sacaron el pan.
    Esta BIEN mirar fútbol y ponerse contento si a uno le gusta, y somos totalmente tolerantes al respecto. Lo que de hecho estamos destacando, es que la gente a la que le gusta el futbol NO es tolerante con aquellas extrañas criaturas(como nosotros) a las que NO les gusta. Sabemos que no es el caso de ustedes, pero no es cuesti´n de mala suerte sino de que a ustedes no los van a molestar x el simple hecho de q les gusta el futbol y ademas probablemente en el momento de ver el partido lo estuvieran viendo y no intentando comprar algo.
    Así como es molesto el flaco escuchando cumbia villera en el bondi, también lo es para nosotros que todo se enfoque en el mundial, y que sea un pais futbolero no nos parece una excusa, xq de igual forma nos podrian contestar: "es un pais que mayoritariamente escucha cumbia asi que manejense", y eso no evitaria que nos molestara.
    No teniamos cara de culo en el bar y ademas las critica y/o insultos que recibims no fueron solo en el bar sino de alumnos, profesores colegas,y mucho otros seres randomicos uruguayos patriotas futboleros.
    Que sea un acontecimiento historico(que o lo es x fuera del ambito futbolístico), que no ganaran 3 partidos cnsecutivos hace una torta de años, que no pasara a los cuartos de final desde la primer flatulencia de mi abuelo el dinosaurio, no es relevante para nosotros ya que nos importa un reverendo, magistral y gigantezco carajo, ya que como afirmamos en toda esta discución: NO NS GUSTA EL FUTBOL, y esos hechos no tienen la más minima importancia fuera de el contexto de tan aclamado deporte.
    No sos nazi por alentar a la celeste xq los nazis no emitieron opinón hacerca del futbol,y tampoco sos intolerante si es a lo que te referis. Lo serias si me dijeras "¡Dale,alentá a la celeste!¿Qué?¿no te importa la patria?Para mi si no te gusta el futbol sos poco hombre" como nos dijeron muchas otras personas que no se llamaban Eduardo ni Javier.

    ResponderEliminar
  12. a lo que me refería con lo de la cumbia era que me lo banco todos los días (TODOS!), esto es cada 4 años y hace 40 años que no era para tanto, pero en fin ya veo que no importa.

    La verdad que la gente que les dijo esas cosas son cualquiera y no puedo creer que sean tantas.

    Como yo ya he dicho, siempre que hablan de los clásicos y Nacional y Peñarol, siempre digo que no soy muy del fútbol y a mi nunca me trataron de marica ni nada, tal vez yo no tengo que lidiar con gente tan cerrada de mente.

    Yo el otro día me di cuenta que era un articulo de doña pocha, por que yo entre acá por medio de un mail que mando Jorge y no entre por el enlace "Doña Pocha", pero no es lo que piensan ustedes lo que ponen como Doña Pocha, usando la ironía?

    Esta todo bien, ya sabemos que por manera escrita las cosas quedan diferentes a cuando las hablamos personalmente.
    Ya lo hablaremos mejor, con Jorge no por que no lo vemos nunca jaja

    ResponderEliminar
  13. Guálter, la verdad que lo tuyo así mirado a simple vista parece poesía y luego de leerlo también, sos un poeta innato valor!
    con repecto alo discutido con Javier, creo que más nada que agregar, salvo que si quieren lo hablamos, pero repito: el artículo e sopinión de doña Pocha.
    Un abrazo a todos los futboleros no futboleros y seres humanos en geal. que han comentado profusamente este post.

    ResponderEliminar
  14. Javier: Despues lo hablamos si queres, claro que está todo bien. Nada de lo que puse lo puse enojado y si sonó asi no era la intención. Me divierte el blog y mas aún que se den estas discuciones, sino no tendria sentido. La función del blog es el intercambio y no puedo creer que todos estén de acuerdo con lo que ponemos. Ustedes sse animan a opinar y dar su opinión a favor o en contra de los temas tratados y les agradecemos eso de verdad.
    El mail no te lo manda Jorge, es un aviso del blog de que subimos un tema nuevo que se manda automaticamente.
    A veces concordamos con Doña Pocha y a veces no. Ella está a favor de la dictadura por ejemplo y nosotros no. Doña Pocha es un señora de as de antes y su pensamiento se desprende de la época en que vivió. A veces se pone caprichosa, pero igual la dejamos postear porque nos paga con favores sexuales.

    ResponderEliminar
  15. jajajajaaa

    Lo que veo es que se esta abusando del termino facho jaja, espero que no me vean como un facho por pensar en algunas cosas diferente a ustedes.

    Saludos

    ResponderEliminar
  16. no se que entendes por facho lo q pasa.

    ResponderEliminar
  17. ta ya fue jaja (ahi se ve tus ansias por discutir jaja)

    Ya hablamos por msn, nos vemos

    ResponderEliminar
  18. No son ansias x discutir de mala manera, discutir de buena manera es una de las funciones de un blog y no tendria uno si no me gustara.
    solo queria saber q entendes x facho para saber que contestarte,jaja.
    Nos vemos javi,saludos.

    ResponderEliminar
  19. Jajaj veo que definitivamente, España no es muy distinta de Uruguay en el tema del fútbol

    ResponderEliminar
  20. Enlil: Ah si?España también enloquece y se paraliza en pos del balonpie?jaja. Entonces descartaremos la idea de huir para allá.

    ResponderEliminar