martes, 29 de junio de 2010

dOCtOR dULCeS sUEÑOS CAP. X -FINAL



Imagen: :La conspiración del mundo de Juanito Laguna trastorna el sueño de los injustos" de Juan Antonio Berni.


Pesadilla


Cuando comencé a soñar, increíblemente sabía que lo estaba haciendo, por más que tuviera esa absurda forma de razonar de cuando uno está durmiendo. Siguiendo la misma, me levanté de la cama arrugada como cada noche, con el sol brillando en la ventana del mundo de mis sueños. Me higienicé lo más que pude, dado que el cansancio y el sueño que siempre tenía mientras soñaba me atacaban mucho más que otras veces y finalmente, me fui a trabajar.
Sin embargo, ese día fue una locura. Anteriormente, cuando soñaba, casi nunca recordaba lo que había pasado mientras estaba despierto, pero esta vez sí, recordaba todo, de tal forma que lo importante para mí mientras soñaba era el mundo real, al cual tenía delante de los ojos como una lagaña que empañaba mi visión del mundo onírico. La oficina, los papeles, la pantalla de la ridícula computadora, todo parecía transparente, obsesionado permanentemente por la idea y la imagen del Doctor Dulces Sueños.
Culminó al fin mi jornada de trabajo después de ocho exactas horas, contadas por un reloj cuya marcha era constante y groseramente física. Caminé a mi casa que siempre quedaba en el mismo lugar y simplemente metí la llave en la cerradura de una puerta sólida e inmutable, logrando entrar al instante. Recibí la llamada de mi exmujer reclamando dinero y después me puse a “pasar” ese tiempo inacabable de los sueños, esperando que terminara de una vez. Ese tiempo que trascurre sin saltar nunca. Tomé whisky y fumé un cigarrillo de marihuana mientras miraba el fútbol luego tuve que usar el teléfono para comunicarme con la pizzería para que me trajeran la cena, ya que no podía evitar pensar como en un sueño y querer comer para no morir de hambre.
Al fin llegó la noche. Tomé pastillas para dormir de una caja, pero esta vez, sabía perfectamente que eran para despertar, ya que seguramente, mal dormido, conservaba la conciencia sin poder evitarlo.
Sin embargo, la noche fue un manchón oscuro detrás de mis ojos, convertido en un reseco gusto a resaca, al despertarme nuevamente soñando al otro día, en la cama arrugada.
Comenzando a asustarme, esa noche aumenté la dosis de pastillas, pero nuevamente, en vez de despertar caí en un pozo ciego e inmóvil, del que volví de un tirón al abrir las pestañas con la luz del sol onírico, nuevamente soñando, en la cama arrugada.
Los primeros días estaba aterrorizado, pero como en el mundo real, o quizás peor aquí, nadie pudo explicarme el porqué pasaba, ni ayudarme. Como dije, en una forma mucho peor, ya que en le mundo real, por lo menos podía hablar libremente de que el Doctor Dulces Sueños no me daba las pastillas. En esta pesadilla, sabía por mi lado inconsciente que sólo de pedir ayuda a alguien explicando que este no era el mundo real, me podía traer consecuencias funestas.
Fue así, entonces, que nunca más desperté.
La pesadilla jamás terminó hasta ahora. Intenté escribir esto aquí, en el mundo de los sueños, para rescatar lo poco de cordura que conservo y que cada vez pierdo más visiblemente. Y cuando releo lo que escribí, me doy cuenta cada vez más, que hay cosas que trastoqué, ya que casi no puedo evitar pensar como si fuera una imagen de los sueños. Pero lo peor de todo, es cada vez que recuerdo a Isaac, la Rosa Intestinal y lo que me dijo una vez en el desierto… Comienzo a dudar una y otra vez acerca de todo y entiendo que debo elegir entre renunciar al mundo para no volverme loco en el sueño o pensar que viví sumido en la locura todo mi pasado, para vivir en un mundo que no deja de parecerme un sueño de locos.


Cuando ya comprendí que no podía despertar, busqué ayuda dentro del mundo de los sueños, pero allí, nadie más que el alcohol parecía poder ayudarme. El alcohol era lo que me hacía sentir más cerca del mundo real.
Y cuando digo esto no me equivoco, ya que fue bajo su influencia que algo con sentido volvió a ocurrirme dentro de la pesadilla sin fin que vivía. Que aún vivo.
Caminaba por la calle invernal, bastante ebrio, cuando me crucé con un viejo rojo como un tomate, con una barba blanca enorme y un tapado color mostaza hasta las pantorrillas. Yo estaba a punto de encender un cigarro cuando lo vi y me di cuenta que había perdido el encendedor, todo en uno.
- ¿Tiene fuego? –le pregunté sin anestesia y con la lengua patinándome.
El viejo, sacó un encendedor del bolsillo de su tapado, como quien saca un arma preparada para un asalto que venía planificando hace tiempo.
- Rosa Intestinal. –dijo con menos anestesia que yo y con la lengua patinándosele.


Fuimos a su casa que era en un altillo gris y ruinoso, al que llegamos atravesando pasillos llenos de sombras y criminales fumando pasta base de cocaína, que como ratas ante la luz, entrecerraban los ojos al vernos llegar. Atropelladamente, el hombre comenzó a mostrarme evidencias, a apilar libros y hojas escritas a mano, a explicarme cosas y nombres, todo al mismo tiempo. La mayoría los desconocía, ocupado sólo en la oficina como estaba en el mundo de los sueños, otros los había sentido nombrar, significando para mí, lo mismo que para el resto de las imágenes oníricas de ese mundo los “sueños” que creen tener en las noches, que les hacen olvidar lo que pasa cuando despiertan.
- La puerta de marfil y la puerta de cuerno, mitología griega… “ibant obscuri sub sole”… ¿No te suena? ¿Virgilio? ¿La Eneida? ¿Canto VI? ¿No? ¿Sigmund Freud, el inconsciente, la creación de la materia onírica a partir de imágenes amplificadas de la realidad? ¿Interpretación de los sueños? ¿Calderón de la barca? ¿Matrix?¿Jung? ¿Platón?
-Nada. –dije, recordando sin embargo, algo que no podía precisar y comenzando a sentir miedo y un gusto amargo en la boca, sin saber por qué.
La explicación fue simple y el coherente plan, que además me había presentado un hombre cruzado por un azar certero, me hacían sentir de nuevo en casa, aunque poco creí de lo que me dijo.
El hombre se alza por sobre la naturaleza de tal manera que los nacimientos exceden la cantidad de almas disponibles, por lo cual una sola alma individual se divide en varios cuerpos, con “mentes” que les hace creer ser almas individuales. Sin embargo, como no lo son, están casi a merced total de los avatares espirituales del cuerpo que conserva la parte “con liderazgo” del alma compartida con los demás. Y ahí, comienza la parte absurda propia de los sueños: el hombre me muestra evidencia. Una foto que sacó en la calle a “la niña”, que en realidad es la mujer que dejé llorando sobre el cadáver de Isaac y que viste de monja. El niño, que en el mundo de los sueños es un fumador de pasta base, fotografiado con cara hosca en uno de los pasillos que acabamos de transitar. Yo, saliendo de la oficina en una foto bastante reciente. Isaac, que es “un pintor poco conocido aún en nuestro país”, en la fotito del folleto de su primera exposición, donde se ven los cuadros “Rosa Intestinal”, “Perla Rosada” con la niña cuando era niña, pintada delante de una perla rosada gigante y la promisoria “Doctor Dulces Sueños”, donde “…parece llevar al reino de las artes plásticas las figuras de las animaciones de Tim Burton, con la constante de su técnica de pintura inspirada en la “onironaútica” ”.
- Atendí mucho mis sueños y llegué a una conclusión después de veinte años de auto psicoanálisis, de alucinógenos, de leer libros de alquimia y mitología y de buscar señales por toda la ciudad con una cámara de fotos…
Puso frente a mi cara la foto de un hombre mayor, con cara de facciones secas y trastornos sicológicos, el cual trasfigurado a una animación de Tim Burton, sería la viva imagen del Doctor Dulces Sueños.
- Este psicótico de mierda aprisionó nuestras almas desde el nacimiento de cada uno de nosotros en su único sueño psicótico, repetido por toda su vida, en su fantasía delirante de ser el rey de un mundo semidesértico donde reparte pastillas y donde las calles tienen enormes muros grises y el agua es arena… ¡Este desgraciado torturó cada una de las noches de mi vida con el mismo sueño traumático, del que cada día desde que fui un poco maduro desperté con la idea de que este mundo era el falso y aquél el real! ¡Este desgraciado me tiene hace más de veinte años, desde que comencé a descubrir todo, encerrado durante varios años por noche en cámaras de tortura, donde muero cada noche, una y otra vez! ¡Este es el idiota que tenemos que matar para ser dueños de nuestros sueños de una puta buena vez! –terminó gritando, mientras pegaba un golpe a la mesa, arrepintiéndose luego de arrugar la foto y alisándola con parsimonia.


No sólo fui el único con el que pudo hablar civilizadamente, si no que acepté hacerlo. Los días anteriores al fijado para el asesinato, comenzó esa horrible sensación de miedo que ya jamás me abandonó. Esa angustia borboteante detrás de cada vez que sonreía pensando en la trascendencia que la imagen de gabardina mostaza daba a un sueño, cuando yo, simplemente tenía ganas de matar una imagen onírica del Doctor Dulces Sueños. Y allí, subía el ácido a mi garganta y recordaba lo que había dicho Isaac en el desierto y comenzaba a dudar si no sería real. Luego, pensaba que esa conversación con Isaac me había hecho desarrollar ese tema dentro de la pesadilla en la que ahora estaba atrapado, pero cuando me daba cuenta que estaba usando el método de Freud al revés, gracias a las malditas explicaciones del viejo; comenzaba a pensar que estaba loco, loco en el mundo real, pensando que éste era un sueño; una pesadilla.
Acepté matar al “Doctor dulces Sueños”. Qué más me daba matar a un sueño. Sin embargo, aunque –como dije antes-, mi conciencia no me abandonaba dentro de esa pesadilla con lógica de pesadilla, pronto comencé a sentirme coaccionado por la moral, el miedo y la idea de que lo que iba a hacer estaba mal o era peligroso, tal como si estuviera totalmente entregado al sueño y pensara que éste fuera real.
Finalmente, el Doctor Dulces Sueños hizo su salida semanal de la enrome mansión en donde vivía. Como en el mundo real, era una figura de cera vestida con un largo tapado negro y acribillado a verrugas, sólo que con forma “humana” como corresponde a los sueños.
Caminó hasta el costoso auto negro que usaría para hacer las compras con que sobreviviría otra semana completamente encerrado con la sola visita de la empleada para cocinar y limpiar martes, jueves y sábado.
Lo miré antes de comenzar la caminata que culminaría con un cuchillo ensartado en sus tripas, lo miré y volví a pensar que sólo de esa forma quedaría libre de él en el mundo real y al fin despertaría y todos seríamos libres de él, de conseguir las pastillas cómo pudiéramos, aunque fuera por medio de las puertas invisibles del desierto, o simplemente no durmiendo nunca más, pero derrocando de una vez al fantoche atroz que -les mostraría a todos- había sido el Doctorzuelo.
- ¿Qué peligro va a haber? –me dijo el viejo- Lo único que puede pasar es que una vez que él muera, los cinco nos quedemos sin alma y muramos también… ¡jajajajaja! –terminando la frase con su exaltada risa de tipo poco dentro de sus cabales hasta para su mundo.
Todo estaba fríamente calculado. Nadie alrededor. Me acerqué a hablarle por la ventanilla justo después de que se sentara. Antes que terminara de negarme la moneda que falsamente le pedí, metí el brazo rápido, atravesé la piel y sentí escupir sangre a los intestinos calientes; retorcí el cuchillo para que el dolor no lo dejara gritar y saqué el brazo y el arma con huellas dactilares de un adicto de los pasillos, todo en uno.
Nos retiramos de las calles desiertas del barrio residencial caminando tranquilamente.
Raúl me dijo que se mudaría del altillo para empezar una vida nueva sin más pesadillas de torturas eternas y que me convendría hacerlo a mí también. Después se fue, aclarando que no lo buscara, ni a él ni a los demás, ni si quiera a la monja, que de seguro era en la que menos podía confiar, que él tampoco me buscaría y que nadie sabía nada.
Esa noche, sólo pude hacerme preguntas. Recordaba en el tacto como había matado a esa persona, ya que no lo miré, recordaba la sensación de la sangre caliente a través del guante ya incinerado y pensaba en por qué no lo había matado el viejo mismo y como había caído nuevamente en una misión parecida a la de la Rosa Intestinal. Me preguntaba si muerto el Doctor en el mundo de los sueños, donde las muertes son definitivas, podría despertar de una vez o si como solía pasar en los sueños, todo lo que me dijo el viejo sería “fantasía”, al igual que mis pretensiones de despertar y que yo abandonara la pesadilla no dependía nada más que del capricho de Dulces Sueños. Y luego me preguntaba si de ser así, si éste aún existiría, o habría muerto allá también. Luego me preguntaba qué me hacía pensar que el delirio de Raúl fuese real y ese tipo en verdad fuera la imagen onírica de Dulces Sueños, o según el viejo, el Dulces Sueños real. Me pregunté por qué el niño y la niña habían decidido no dormir en el mundo real, por qué nunca me había cruzado al viejo en él y sobre todo por qué, por qué el Doctor Dulces Sueños había iniciado todo esto, negándose a verme, negándome una miserable pastilla que él mismo había establecido obligatoria para dormir.
Esa noche no pude dormir y la angustia me hizo temblar y morirme de miedo al acordarme de nuevo de lo que Isaac me había dicho en el desierto y de pensar que fuera verdad.
Pero cuando cerca del mediodía me pude dormir, no desperté como esperaba, ni soñé los “sueños” que creen tener las imágenes oníricas de los que sueñan y esto se repitió todas las noches desde entonces. Comprendí que así, no tenía como comprobar ya cual mundo era real, ni si estaba despierto o dormido, ni cual era la verdad, o si la realidad era algo real y que con lo que había hecho, ya no podría nunca conformarme con creer realidad lo que yo percibía como tal.
Cada día necesito tomar más pastillas para dormir sin que el psiquiatra pueda evitarlo y cada mañana, descubro una nueva verruga en mi rostro que empalidece, sin que el dermatólogo pueda hacer nada. Como de cera.

EL VIAJE HACIA EL BAR CAPÍTULO IX -FINAL



IX
LLEGADA AL PUEBLO DE SAN CAVERNET


Como nuestros queridos lectores imaginarán, todo en la vida tiene un comienzo, un desarrollo y un desenlace y estos tres momentos (tanto en la vida real, como en las historias más o menos ficticias) no pueden ser alterados en su orden, ni tampoco puede faltar ninguno de ellos, sin el peligro de que la historia pierda su “sal”, más allá de que el comienzo y los primeros capítulos de este cuento no cuadre con la narrativa tradicional y carezca de algunas de sus técnicas canónicas como presentación de los personajes, ubicaciones exactas y situaciones verosímiles, entre otras. Como sabéis, la nuestra es una historia de dos pícaros con suerte, que un día, en busca de aventuras, abandonaron su pueblo natal y partieron casi con nada (premisa de lógica dudosa), a un largo, difícil e incluso peligroso viaje. Muchas veces en su trayecto, tanto por haceros reír, como por los caracteres atolondrados de los mismos mozalbetes, vivieron tragos duros, que sin embargo -gracias a su propia astucia, como a la protección que Dios le brinda a todos aquellos inocentes, que si obran erradamente lo hacen sin maldad- ; lograron sortear sanos y salvos físicamente. A los sumo (para aprender a ser precavidos y astutos), corrieron algún que otro susto, fueron atacados por ancianos furibundos, vagaron a la deriva sin saber dónde estaban, no pudieron dormir, se murieron de hambre sed y abstinencia, los persiguieron animales salvajes, fueron humillados y golpeados en una taberna de truhanes, estafados y robados por prostitutas, riñeron entre ellos, se hicieron perseguir por el sheriff de su pueblo natal, provocaron la muerte de éste y luego tuvieron un pedido de captura que aún pende sobre sus cabezas, aunque nunca se enteraran de ello, dado que nunca pudieron volver a su pueblo.
No obstante, para que veáis que entreteniéndoos, también podéis aprender, la moraleja de esta historia, es que no hay que cejar en nuestros empeños ante el primer tropiezo, si no perseverar, como justamente no hizo uno de los mozalbetes que partió a la aventura en un principio. Sin embargo, el otro chico, Bernardo, tuvo la fuerza de voluntad suficiente para no dejar de luchar ante ningún embate y así, la vida lo recompensó, brindándole lo que éste más anhelaba en el fondo de su alma.
Ahora veréis cómo.
Bernardo llegó al pueblo de San Cavernet y lo recibió el alcalde de la ciudad, que era un hermano gemelo lejano del alcalde García. Le hicieron una fiesta de bienvenida, porque no se permitía a los forasteros salir del pueblo una vez que habían llegado allí. Entró a un bar. Estaba prohibida la venta de alcohol dentro del pueblo, porque era para importaciones. Allí todo el mundo se emborrachaba con leche.




Fin


HASTA LAS PRÓXIMAS ANDANZAS DE bERNARDO Y KIZÁS DAMIÁN!!!!!

viernes, 25 de junio de 2010

Con los milicos estábamos mejor



Cómo anda la familia uruguaya?
Aquí estoy de vuelta con Vds. mi nombre es Doña Pocha y hoy sí, vengo orgullosa a trabajar en este programa por internés, como la aicarli esa. Vengo contenta, no sólo por los triunfos fubolístico de Uruguay en el mundial de fulbo, si no, porque hoy, nuevamente comienzo a creer en que los uruguayos (quizás motivados por haberle roto el culo a los extranjeros comunistas esos como los mejicanos y todos esos putos con próceres como pancho villa y cantinflas, no con crás como artigas), puedan ser rectos, derechos y reclamen que vuelva la ley y el orden.
Así que... ¡Brindemos!

Sí mijito, qué tanta cosa. Es que la gente se queja, pero ta todo patas pa arriba. Vos fijate, que la gente no quieren que haya patrones que manden, ni que hayan clase sociale, ni ricos y pobres y yo siempre les digo a mis nietos: ¿Y si no hubiera ricos que te dieran trabajo los pobres de que viviríamos eh?
¡Ja! Y ahí se callan la boca en seguida y se dejan de: "Y qué fue primero: ¿El huevo o la gallina?" y "Yo sólo sé que no se nada" y "En un lugar de La Mancha que no me acuerdo porque la lavé" y todas esas pavadas que les enseñan en el liceo y la escuela.
Bueno, me voy a apurar que dejé la leche en el fuego.
Lo que quería compartir hoy con toda la familia, es esta preciosa carta, que cuando los integrantes de "Piñazo e frente" fuimo a comer al Bar Manchester (cito en 18 y Convención), encontramo pegada en la carta o menú -como dicen los putos que se hacen los bien hablados.
¡Una carta tan linda que dice tantas verdades! Y claro, pero estos mocosos de mierda, mal educados como la Blackcat, que se quejan de los milicos y no saben que vivíamos mejor con ellos, agarran y se calientan porque les digan la verdad y encima después cuando no les quieren traer pizza porque además no están mirando el partido se enojan... ¡Yo no salgo más con estos guachos culo cagados! Ya cuando sienten cabeza y tengan una familia normal e hijos y vengan y les roben la casa, violen a su mujer, hijos y mascotas y les rompan el florero de la Dinastía Ming van a ver... ¡Y que no se quejen! Porque yo les voy a decir: ¡Ah pero usté estaba en contra de los milicos, así que jódase!" Tendrían que escuchar lo bien que habla sobre los militares nuestro honrado presidente y dejarse de tantas pavadas.

Bueno, ahora para quienes tengan oídos para oír (como decía José Andrea), acá va la carta que pueden encontrar pegada en la carta (o menú) del Manchester. Si no me creen vayan a mirarla uds. mismos y si no me creen que está circulando desde Argentina y que figura en blogs de personas que se dicen anarquistas, revise por ahí por la internés.


Carta de una madre a otra madre: DE MADRE A MADRE:


Vi tu enérgica protesta delante de las camaras de TV en la manifestación de ayer en favor de la reagrupació n de presos y su transferencia a cárceles cercanas a sus familiares.
Vi cómo te quejabas de la distancia que te separa de tu hijo y de lo que supone económicamente para vos ir a visitarlo como consecuencia de esa distancia.
Vi también toda la cobertura mediática que dedicaron a dicha manifestación, así como el soporte que tuviste de otras madres en la misma situación y de otras personas que querían ser solidarias contigo y que contabas con el apoyo de nuestra presidenta y su corrupto esposo, comisiones pastorales, órganos y entidades en defensa de los derechos humanos, ONGs etc. etc.
Yo también soy madre y puedo comprender tu protesta e indignación.
Enorme es la distancia que me separa de mi hijo.
Trabajando y ganando poco, idénticas son las dificultades y los gastos que tengo para visitarlo. Con mucho sacrificio solo puedo visitarlo los domingos porque trabajo incluso los sábados, para el sustento y la educación del resto de la familia.
Felizmente también cuento con el apoyo de amigos, familia etc.
Si aún no lo sabes, yo soy la madre de aquel joven que murió cuando se dirigía al trabajo, con cuyo salario me ayudaba a criar y mandar a la escuela a sus hermanos menores y que fue asaltado y herido mortalmente de un tiro que realizo tu hijo. En la próxima visita,cuando tu estés besando y acariciando a tu hijo yo estaré visitando al mio y depositándole unas flores en su tumba.
¡Ah! Se me olvidaba: ganando poco y sosteniendo la economía de mi casa, a través de los impuestos que pago, tu hijo seguirá durmiendo en un cómodo colchón y comiendo comida caliente todos los dias.
Otra cosa querida: ni al cementerio, ni a mi casa, nunca vino ningún representante de esas entidades que tan solidarias son con vos, para darme apoyo, ni dedicarme unas palabras de aliento y ni siquiera para decirme cuales son MIS DERECHOS.
¡Si estas de acuerdo con esta carta, hazla circular! Quien sabe entre todos podamos revertir esta inversión de valores, que existe en nuestra Argentina, donde los delicuentes tienen más derechos que los ciudadanos normales que solo queremos vivir en paz.


¡LOS DERECHOS HUMANOS SON PARA HUMANOS DERECHOS !
Julia E. Fabiano

EL VIAJE HACIA EL BAR CAPÍTULO VIII



¡El peneúltimo capútulo de la aventura!


VIII
UNA CARRETA LLENA DE LICUADORAS


La noche cayó como un velo de tinieblas sobre los inhóspitos campos donde pocos humanos habían hollado. La naturaleza hermosa, maravillante, que Dios creó para regocijo y consuelo de sus vástagos predilectos, se cernía ahora sobre Bernardo como algo amenazador y desconocido. Los miedos de su alma afligida, sumados al dolor de la pérdida de sus dos entrañables amigos, le hacían contemplar los bultos informes y oscuros que lo rodeaban como un ejército de monstruos rampantes, allí donde horas antes contemplara el más embriagador paisaje silvestre de todo el universo.
Y sucedía, que él contemplaba proyectados fuera de sí, los pesares que embargaban su corazón. Pensaba en todo lo que había ocurrido a partir de unos días atrás y mientras lloraba, gemía en voz baja:
“¡Oh! Yo tenía un bello hogar, en un pueblo donde todos me querían y apreciaban. Era el mejor de mi grado y el más mimado en mi candorosa familia, que mal o bien, más allá de algunas discusiones y alguna prohibición autoritaria de mi venerada madre (¡que yo tan a mal tomaba, pero ahora comprendo, eran tan útiles para evitarme penas y sufrimientos sin par!), era más que una simple familia, una especie de jardín del Edén. ¡Oh sí, Dios! ¿De qué otra manera expresar las delicias y bondades sin fin que yo encontré en el cálido regazo de mi madre y mis hermanas, como en los fuertes brazos de mi robusto padre (cuando me golpeaba hasta desmayarme), que el Señor llevó al cielo tan joven? ¡Era como el jardín del Edén! ¡Oh! Mi padre era como el fuerte nogal sobre el que se apoyan las florecillas silvestres y las zarzas, alrededor de las cuales zumban abejas, mandrágoras, trolls y otros hermosos animalillos buscando el sustento para sus polluelos… mi madre, era como la delicada flor de loto sobre la que se posa la mosca que huye de la planta carnívora en la que se posó su hermana… mis hermanitas eran como otras flores que hay ahí alrededor y que son muy lindas y perfumadas también; tanto que las parejas de enamorados, ante su visión, primero se ruborizan y maravillan ante tal manifestación de la divina presencia del Creador en todas sus criaturas que creó, luego, piensan en tomar algunas de esas florecillas para así, obsequiarlas a su parejas y finalmente; deciden quedarse con la flor para ellos y dejan a su pareja de lado, ante tal arrobamiento, o arrobación. ¡Oh!”
Conteniendo los mocos, Bernardo sollozó y aprovechó para respirar y continuó su largo lamento:
“ Y yo… yo… ¿Qué soy yo? ¡Oh, señor! ¡Perdóname! ¡Oh! ¡Yo soy como el cardo que afea y afeanta todo el conjunto de hermosos conjuntos de pétalos, tallo, pecíolo y otras partes de la anatomía botánica de las plantas vegetales! ¡Oh! ¡Soy como el árbol del bien y el mal que tentó a Eva a agarrar una serpiente y comérsela y como la pecadora… ¡Oh, doblemente pecadora! No conforme con condenarse a sí misma al fuego del infierno imperecedero, con saña, envidia, resentimiento, perfidia y sicilia, obligó a Adán a comer también de tal fruto, condenándonos a todos los hijos de Adán y Eva (que eran ellos), al error, la perdición, el pecado y a tener que comer manzanas… ¡Sí, ese soy yo Señor! ¡Oh!”
“¡Oh! ¡De la misma manera que Eva condenó a Adán y a toda la raza humana a la perdición, yo, con mis alocadas ideas de tomar alcohol, tener aventuras y conocer pueblos lejanos y mujeres con portaligas (tan semejantes a Eva y a aquella María Magdalena, que no era la madre de Jesús, nuestro redentor, ya que esta se llamaba María a secas), no solamente abandoné al sufrimiento y la contrición, la convicción y conflagración a mi amada familia (que quién sabe si volveré a ver), si no que (infelizmente), arrastré a mi mejor amigo (Damián) y una de las mejores personas del pueblo (el sheriff, que no sé como se llamaba), a un destino aborrecible (ver capítulo anterior) y otras cosas (que no vale la pena aclarar)… ¡Oh sí, yo soy el pecador! ¡Oh Dios, perdóname, o si me quieres castigar, como fueron castigados, condenados al desierto los hijos de Caín y Abel, sin si quiera tener la esperanza de encontrar la ciudad de Somorra… ¡Oh! ¡Oh! ¡Oh! ¡Yo lo aceptaré y lo aceptaré de buena gana y es más; te conminaré a qué me apliques el doble o el triple de tormento y te apuesto ahora mismo la cantidad que quieras a que me la banco hasta expurgar todos mis pecados! ¡Oh! ¡Oh! ¡Oh!”
Sin resistir casi tanto dolor y sufrimiento, Bernardo, quedó -luego de tan largo párrafo-, sollozando sin aliento, expurgando por medio de las lágrimas su pecados y también el exceso de tóxicos en su sangre.
Sin que él lo notara, cegado como estaba en su autopunición, las pequeñas ardillas, mangostas y manatíes que poblaban aquél bosquecillo donde se encontraba, se acercaban y veían su tormento, conmoviéndose y pensando en ayudar al chiquillo, que no era tan malo como creía, sobre todo porque el primer paso a la salvación, queridos lectores, es reconocer los errores y confesarlos ante las autoridades, que en este momento no estaban al alcance de Bernardo, pero que de seguro no deben faltar en el centro comunal, iglesia o asociación social y deportiva de su barrio, así como en las estaciones de policía más cercanas.
Sin embargo, los animalillos no sabían cómo conformar a Bernardo, hasta que éste, liberado y puro como un niño (que era y seguiría siendo por siempre), soltó con un suspiro en el medio de su llanto:
“¡Oh, Dios, pero si supieras… ¡Oh! si supieras que nada lo hice por maldad, que en nada tuve mala intención… ¡Oh! si supieras que todo esto lo hice por la vana e infantil ilusión de llegar al pueblo del alcohol y aunque sea, probar un poquito de esas maravillosas bebidas que tienen todos los más hermosos colores de tu creación insuperable por la coctelería humana! ¡Oh!”
¡Pobrecillo Bernardo! Lo que en su inocencia, no sabía o no recordaba, es que Dios (como los narradores que predominan en la literatura moderna y que por lo general también son heterodiegéticos), es omnisciente, lo cual quiere decir que sabe todo, incluso lo que pasó y lo que va a pasar y lo que no pasó, pero igual espera a ver que hacemos para perdonarnos y todo lo demás, porque tenemos libre albedrío y otras cosas que no se contradicen dentro de una visión teológica más vasta que no puedo explicar acá. Por esto, como no tiene capacidad de acción directa (más que en casos extremos como la iluminación entre otros), había enviado a los animalillos buenos, para que éstos (que a su vez tampoco tenían poderes sobrenaturales), escucharan lo dicho por Bernardillo y se lo comunicaran… ¡Sí! ¡Al hada madrina del niño!
En un buró en un ombú de 250 años de antigüedad, se oyó de pronto los golpes de una cantidad de pequeñas patitas, de animalillos que alegres por la buena acción con la que colaborarían, esperaron ansiosos detrás de la puerta por varios segundos. El Hada, que estaba ocupada en unos trámites burocráticos con un pequeño duendecillo, atendió finalmente la puerta con voz agitada.
Los animalillos alegre, bulliciosa y entreveradamente le contaron al hadilla lo que le pasaba al chiquillo y esta no entendió nadilla y les tuvo que pedir unas cuantas repeticioncillas, hasta que cansadilla, se sentó en una silla y aunque entreverada y finalmente, entendió mente por fin lo que querían decirle.
Y (¡Oh, grata sorpresa!), cuando Bernardo despertó, se encontró con que estaba en medio de la ruta, inexplicablemente. Se levantó de golpe, sobresaltado por las cariñosas palabras de unos conductores de carretas que casi lo habían atropellado, pero finalmente sólo le pasaron por arriba.
Bernardo, que se creía ya muerto, comenzó a llorar y a gritar:
-¡Oh, Dios! No has escuchado mis súplicas y he de merecerlo, ya que soy un pecador. Moriré sin poder pedirle perdón a todos aquellos que tanto me quieren y que sin embargo, he dañado y afligido con mis endiabladas travesuras y que con toda razón quizás ya no me quieran más… ¡Oh! Morir sólo en el mundo, con hambre, sueño, resaca (todavía me dura), sin tomar la deliciosa y fresca leche desde hace días y…
Bernardo calló un momento y luego, como un inocente niño que era, dejó libre su corazón, más allá de su arrepentimiento:
- Y sin ni si quiera tener una gota de maravilloso alcohol, para llevarme a la boca antes de morir (si es que ya no soy un frío y pálido cadáver), de ese elixir de los dioses, por el que ingenuamente corrí y dejé atrás todo… todo…
Y luego, ya no pudo hablar más, dejando correr un mar de lágrimas.
Sin embargo, Bernardo escuchó algo y su sentido común le indicaba que los muertos no escuchan.
Levantó la vista y vio como los dos hombres bonachones que conducían la carreta, lloraban conmocionados con lágrimas que llegaban hasta sus mostachones de color marrón claro como toneles.
Entonces, Bernardo comprendió que lo habían escuchado e hizo un simple silogismo (todas las personas vivas escuchan hablar otras personas vivas, Los señores bonachones son personas vivas y escucharon hablar a Bernardo, por lo tanto los señores bonachones y Bernardos están vivos). Y tal silogismo, fue como ver salir el sol luego de una furiosa tormenta nocturna.
Bernardo, loco de la vida, se levantó y vio que no tenía más que algunos rasguños y una o dos docenas de hematomas, además de haber perdido cuatro o cinco dientes delanteros… ¡Estaba vivo!
De inmediato, los señores bonachones bajaron a auxiliarlo y le ofrecieron todo lo que tenían para resarcir el accidente que provocaron por su impericia al conducir.
- Discúlpanos pequeño mozuelo –dijeron al unísono los señores-, es que veníamos algo borrachos y pensamos que eras una bolsa de arpillera llena de coles de Bruselas. –en efecto, se notaba que uno de ellos además de estar ebrio, usaba unos lentes gruesos como fondo de botella- Como recompensa a los daños ocasionados, siempre que no presentes cargos ante un juez competente, te ayudaremos en lo que necesites. ¡Te daremos lo que pidas!
Bernardo, sin creer aún, que a veces en los trances más dolorosos, Dios se acuerda de nosotros y nos da un fruto de oro colgando de la ortiga, pensó en pedirles muchas cosas, pero antes preguntó creyendo intuir la respuesta:
- Borrachos… o sea, en ese estado de felicidad estúpida en el que uno queda luego de tomar mucho alcohol, por lo menos hasta el otro día, cuando tiene resaca, se acuerda de lo que hizo (o ve las consecuencias y comentarios) y tiene que pagar la cuenta?
- Claro, claro chaval –dijeron riendo los señores-. No es algo que esté muy bien visto (a no ser en entornos socialmente aceptados para ello, como cumpleaños, casamientos Navidad, Fin de Año, asados con amigos, salidas a los bailes cada fin de semana, bautismos, barmitzvas, velorios, entierros, citas amorosas, salidas al cine, salidas a comer, cenas almuerzos o meriendas en casa, al ir a un motel con un amante, etc.), mas la gente ruda pero amable y caritativa como nosotros, lo hacemos siempre. Sabes, nuestro oficio es muy duro, conducimos carretas que transportan licuadoras desde los más lejanos pueblos, hasta el pueblo de San Cavernet, donde las convertimos en máquinas de escribir. Debemos hacerlo aunque nos pese, ya que si no, nuestras familias y tantos chiquillos huérfanos no comerían su pedazo de pan negro y su bota de leche cortada con clericó, ya que el 40% del ingreso bruto de nuestro pueblo es del rubro licuadoril y el otro 80 %, es el de la exportación del alcohol, que por suerte Dios hace crecer hasta en las fuentes de nuestras plazas…
Bernardo se asombró, no podía creer que al fin sus deseos se cumplirían.
-Ustedes… ustedes… ¡Van al pueblo del alcohol! –dijo balbuceando y rompiendo en un llanto, esta vez de felicidad.
Los señores bonachones, compungidos al no entender que no era un llanto de tristeza se disculparon:
- Sí, disculpa muchacho… ¿Mataron algún pariente tuyo ahí?
Bernardo, llorando esta vez de negación de la premisa del interlocutor, contestó:
- No… es que no lo puedo creer, hace días que vengo penando por llegar a ese pueblo, mi aventura comenzó hace días…
Brevemente, les contó la historia que vosotros ya conocéis y finalmente, admirados y con lágrimas en los ojos y las orejas, los dos adultos le propusieron enternecidos:
-¡Entonces muchacho, no nos queda más que llevarte hacia tu sueño hecho realidad!
En momentos, los tres partían llorando de regocijo e intercambiando anécdotas de borracheras y leche, en un largo pero esperanzador viaje hacia San Cavernet, que Bernardo hizo dentro de una licuadora, llorando de viaje.

dOCtOR dULCeS sUEÑOS CAP. IX



La puerta de marfil


Cuando al parecer se hizo el día, la habitación se dio vuelta y caímos al piso por la rejilla que estaba abierta. Yo pude frenar el golpe un poco con las manos, pero no sé cuánto se lastimaron los que dormían y que empezaron a despertarse.
De inmediato se abrió una puerta por la que entró un hombre de túnica anaranjada (quizás el mismo que la primera vez que estuviéramos en el Palacio de Sueño) y nos señaló una puerta blanca que había justo en frente de aquella por la que él saliera.
Aún algo dormidos, los otros dos caminaron junto conmigo en esa dirección.
- ¡Quiere entregarte al Doctor Dulces Sueños! –dijo ella intentando detener a Isaac, pero éste, empujándola le ordenó:
- ¡Caminá! Él me salvó la vida y le debo mi lealtad, no voy a dudar de él por tus habladurías de víbora venenosa.
Isaac, que ignoraba que era la Rosa Intestinal, no pensó si quiera un momento que las palabras de la niña tuvieran algo de verdad. Yo lo estaba traicionando, pero al parecer él no lo hacía conmigo. No me sentí culpable, si no confundido. ¿Qué sentido tenía lo que él me había dicho? ¿Sería sólo un loco? ¿El Doctor Dulces Sueños le había mentido o también era un loco, o quizás no tuviera nada que ver con los inventos de Isaac? ¿Cómo el Doctor Dulces Sueños no sabía que la misma persona que había mandado a buscar la perla rosada era la Rosa Intestinal? ¿Qué eran y para que quería la perla rosada y la Rosa Intestinal? ¿Por qué yo no podía dormir, por qué no me veía?
Aún podía tener alguna posibilidad de escaparme al desierto, pero ya no quería, ahora, lo que quería era saber. Nunca había sentido que hubiera una verdad que saber, una verdad única con v mayúscula.
Cuando cruzamos la puerta, nos encontramos de vuelta en la sala con la mesa interminable, había cuatro sillas de nuestro lado y el Doctor Dulces Sueños ya nos esperaba sentado en su trono igual que siempre, como si fuera un robot o un muñeco.
Nos sentamos. La niña con cara de torturada, Isaac con la mayor costumbre y yo, decidido a que el Doctor Dulces Sueños no desapareciera por la puerta negra hasta contestar todas mis preguntas.
-La perla rosada –dijo sin ningún entusiasmo.
Isaac, con un gesto triunfal, sacó de algún lugar de su ropa la perla y la arrojó rodando por la mesa con tal precisión que terminó en la mano del fantoche de cera. Éste la observó por un momento, sin demostrar ninguna emoción y luego dijo:
- La Rosa Intestinal.
Isaac abrió los ojos enormemente. Yo, lo más rápido que pude, levante su túnica y mostré su tatuaje. Isaac sólo siguió mirándome sorprendido.
- Muy bien. –dijo el Doctor.- ¿Dónde está el niño?
Me quedé anonadado.
-¡Murió! –dijo la mujer y comenzó a sollozar.
Hubo un momento de silencio.
-¿Y la niña?
-Es ella –dije señalando a lo que ahora era una mujer como de unos veinticinco años.
El Doctor Dulces Sueños me miró fijamente. Por lo menos podía saber que me estaba mirando al fin. Y que me escuchaba.
Levantándose lentamente, me dio una cuchilla sin mango, hecha de algo muy similar a la piedra, aunque más brillante.
- Dame la Rosa Intestinal.
Isaac me miró sin miedo.
- No voy a oponer resistencia. Te juré lealtad.
Sentí miedo y asco, mientras la niña se arrodillaba a llorar y pedir por favor que no lo mataran, ya sin ofrecer sus servicios sexuales a cambio.
De pronto, sin que yo me decidiera, Isaac tomó mi mano y con fuerza la clavó en su abdomen.
- Quizás morir acá sea la única forma de despertar allá –dijo y luego se calló. Calló, aguantando el dolor no sé cómo, mientras yo tembloroso, cortaba dificultosamente un churrasco de sus músculos abdominales, arrancándole el maldito tatuaje de la Rosa Intestinal.
De pronto yo estaba en el suelo, temblando, agarrándome la cara con todas las manos ensangrentadas. Cuando levanté la vista, la niña lloraba aferrada al cuerpo muerto y ensangrentado de Isaac y Dulces Sueños se ponía una servilleta blanca al cuello.
- Las perlas disueltas en arsénico son mis favoritas –dijo como para sí mismo, volcando del veneno sobre un plato donde estaba la perla rosada. Al lado de dicho plato, vi otro con un enorme churrasco al horno, cubierto de salsa y pétalos de rosas.
-¡Mis pastillas! – grité, sin acordarme de su perdón y sin que me importara.
Sin embargo, él siguió comiendo con deleite, mientras se servía vino en una copa.
- Delicioso –dijo al aire, como si yo no estuviera ahí.
A punto de estallar en ira, no lo hice. Era inútil. Él podía todo lo que quería.
- ¡Mis pastillas! ¡Traje la Rosa Intestinal!
Pero él seguía comiendo. Razoné qué quizás no había cumplido con traerla con los dos con que había partido al desierto, por lo cual ya estaba jugado. Nunca podría volver a conseguir las pastillas, a menos que Dulces Sueños quisiera.
Desesperado, corrí hacia el hijo de puta y comencé a golpearlo, pero mis puños lo atravesaron como a un espejismo. Cuando me cansé de pegarle y terminó de comer, chasqueando los dedos, hizo a parecer al niño, que ahora vestía una túnica naranja y tenía aspecto de zombi, diciéndole que me llevara no sé a dónde, porque al instante me encontraba en un calabozo. Las paredes y el techo eran de metros y metros de altura y mirando al infinito no llegaba a verse el final del mismo. Estaba húmedamente oscuro y al lado de las pocas antorchas que había, se veían montañas de huesos amarillentos.


Caminé por el calabozo interminable y nunca encontraba la salida o aunque sea la pared que ya no me dejara avanzar. Pasó tanto tiempo sin día ni noche, que no sé decir cuánto fue. Quizás milenios o varias eternidades o quizás, sólo horas de tanta desesperación que fueron varias muertes de la eternidad para mí. Me alimenté de los cadáveres que conservaban carne y qué nunca supe por dónde llegaban al calabozo, pero sufrí de sed por toda mi estadía. Y seguía sin dormir.
Entonces, en algún Eón de mi estadía en esa celda infinita, vi que entre mis ropas había un frasco aún casi lleno de pastillas de dormir, que había olvidado o quizás decidido no tomar por miedo a morir en manos de vaya a saber qué, en ese calabozo que en realidad olía a trampa.
Sin dudarlo un segundo, las tomé, todas. Eran más de cincuenta pastillas, quizás ni si quiera me harían efecto, por el tiempo inmemorial que distaba desde la última vez que había dormido. Quizás mi destino era no volver a dormir jamás, hasta deshacerme en un charco de agua. Ya no medía posibilidades, ya no tenía intereses, actuaba ciegamente y era imposible que ordenara un pensamiento en mi cabeza.
De pronto, me encontré de espaldas a una enorme puerta de marfil, tan enorme como el Palacio del Sueño o más. Esta se estaba cerrando y yo la acababa de atravesar. Pronto, recordé todo lo que me había dicho Isaac, la Verdad, el Doctor Dulces Sueños, todos los qués y los por qués, pero seguí caminando hacia una cama a unos pasos delante de mí y me dormí.

martes, 22 de junio de 2010

Erklaren/Verstehen/Festejen uruguayos no má!!!!!!!



Uruguayos festejando el triunfo futbolísitco ante México.


¿¡Cómo les va queridos niños y amas de casa!?
A los hombres de la casa (Dado que como corresponde, todo hogar debe contar con una mamá un papá y los niños, siendo el que dirige y organiza a toda la fmailia quien porta el pene, como otrora quien portaba la espada y ahora el que tiene el celular más caro de la tribu urbana) ni les pregunto... Por que no están... porque están...
¡Jajajaja! Sí... ¡Qué alegría para todos! Están festejando lo más parecido a ser una potencia colonial como España, ganarles el virreinato a los bonaerenses o que los franceses reconozcan que Gardel nació en Tacuarembó... ¡Sí hoy es un día de gran algarabía patoteril... perdón patrioteril, dado que nuestra pequeña Suiza de América y ahora país bananero... socialista (para mí estábamos mejor con los milicos)ha clasificado para el mundial de fulbo en sudafricaca... ¡Y mirá vo! En un país esótico clasificó, no acá no más... sabés lo que debe ser andar ahí en el medio de sudáfrica con todos los negros esos, chorros que te roban a tus hijos para violarlos y comerselos alrededor tuyo, bailando el guaca guaca como Shakira y Juan Carlos Priscione...
Sí, no saludo a los esposos, ya que stán festejando el partido que hoy Uruguay le ganó a México, por lo cual





1)No pasaron los ómnibus.
2)No se podía preguntar a quién estuviera en la parada por qué no pasban los ómnibus sin que te miraran con cara de "¡Antipatriota te denunciaré!" y te dijeran: "¡Ah, es por que está jugando Uruguay con México y viene ganando..." y luego pusieran una gran sonrisa de felicidad y vos te preguntes de qué te tendráis que alegrar de que no pase el ómnibus.
3)En la tele te mostraban super contentos y orgullosos, como en ciertos liceos en vez de dar clases (a estos chiquilines de ahora, que no saben ni leer ni escribir y son unos maleducados peoncitos del sistema, ignorantes, consumistas y sin pensamiento propio, sobrevalorados por repetir unas consginas seudo-progresistas como no lo hacían las generaciones anteriores por repetir eslóganes igual de fachos pero de corte paisito burgués), les hacían mirar el pertido junto a Alex Mazzei y otros hijos de putas mantenidos con nuestros impuestos, y gritar y saltar con banderas pintarrajeadas en a cara como unos monos. Sólo les faltaba decir "Hail Pepe" y ya estaba.
4)Jorge "Pollito" Manco tuviera que bancarse la cara de culo de todo el mundo por tener el descaro de decir que el fútbol no le gusta ni le interesa.
5) Que en blogs seudo-intelectuales de gente que se dice anarquista, después de poner un posts super crítico hacia el mundial, pusieran igual posts sobre fútbol, porque "la mayoría de los seguidores son de Argentina y bue, los Argentinos ganaron un partido y viste... hay que hacerles algún mimito demagógico a las personas en el clítoris chauvinista.."
6)Que si vas a pedir una pizza en el Bar Manchester (cito en Convención y 18) pero estás sin mirar el partido, te digan que no tienen y no pidas por un rato, mientras a a las otras mesas de borrachos cavernícolas que gritan como nazis patoteros les sirvan en tu cara.
Por lo cual, si Ud. es un antipatriota de mierda como J. "Pollito " Manco o Talthec y se asombra y trata de razonar con la gente cuando te dicen tan sueltas de cuerpo que por ejemplo no te van a prestar un servicio público indispensable, o no vas a trabajar después de haber llegado en hora porque "Hay partido", Ud. debe saber:
1) Mirar el partido y alentar a las nuevas generaciones en el fanatismo irracional, el maniquismo y la incuestionalbilidad de las costumbres racionales más rancias, también es educación. Después sale dieciendo "la religión es el opio de lso pueblos2 y ya alcanza para que nadie diga que esun fanático irracional y mongólico.
2)Si no te gusta el fúlbo, igual tenés que mirar losprartidos , alegrarte y andar todo eufórico pro la calle porque "Es la celeste".
3)Hay que ser patriota.
4)Si preguntás "¿Qué es ser patriota?" y no te alcanza la respuesta: "Apoyar a la celeste, porque todos están contentos, porque gana Uruguay", como si los tres millones de habitantes hubiesen estado en el estadio corriendo atrás de una pelota como unos pelotudos, es porque "Estás loco","Te hacés el rarito", "Sos puto",etc.
5) Si preguntás porque habrías de ser patriota, vas a ser insultado.
6) "Hay que apoyar a la celeste, porque hoy todos los Uruguayos están unidos, no es como otros días de fulbo, en que los de Nacional y Peñarol, como son enemigos, se insultan y llegan a lastimarse, hoy todos son amigos en el Uruguay y todos nos tenemos que sentir identificados con el triunfo de la selesión".
9807654,5)La manga de navos patasucias que corren como unos giles atrás de una bola hecha con cachos de vaca muerta deshollada con un trapo celeste por arriba de sus torsos peludos de cavernícolas son semidioses que luchan por la honra de nuestra nación y deben ser admirados como en la antigua Grecia se admiraba a Héctor, Menelao y Heracles.





Uruguayo escuchándote explicarle por qué no te gusta el fútbol.


Así que para todos los no comunistas-antipatriotas-gueys que nos están mirando aún, un gran abrazo y festejemos... ¡¡¡Festejen uruguayos!!! aprovechen ahora antes de que los caguen a puñaladas afuera del estadio por ser de otro cuadro (lo cual está bien, porque el fubol es un sentimiento y deporte de hombres)y abracen el sobaco mugriento de su hermnao uruguayo que grita babenado cerveza: "¡Vamo, vamo Uruguay no má!", agitando el cáncer producido por la contaminación provocada por una de las empresas que patrocina el mundial y llegue a su casa de resaca directo a pegarle a su esposa e hijos porque no le dejan escuchar el partido...
Festeje y no s eprecocupe por la comida; hoy doña Pocha e da una receta muy fácil para la cena:


Hamburguesas de diez pesos para festejar el mundial:


Ingredientes:
-Una Tele con Cable.
-Hamburguesas de diez pesos.
-Una bandera de Uruguay colgada en la puerta de su casa (los demás son enemigos, si viene la peste y ve esa bandera sigue de largo, matando a los Argentinos y otros que no importan).
-La familia unida por el fubol.
-Una maza de picar concreto.


Después de ir al almacén y compar las hamburguesas (fíjese que sea de las que tienen bastante grasas y no alimentan un carajo), quédese conversando sobre el partido como si fuera lo único que le importara en la vida. Llegue a su casa. Cuelgue la bandera de forma que no se vea para adentro de las ventanas. Prenda la tele. mientras sus hijos estén distraídos viendo a Sahkira vistiendo una falda de paja y diciendo "guacaguacaguacaguacaguaca" mientras tiene movimientos espásmicos, agarrelos a martillazos (cerciórese de que hayan estado lo suficientemente expuestos a a la educación o la tele antes de esto). Con la mierdra que bortara abundantemente del cráneo de lso niños/adolescentes, embadurne las hamburguesas después de haberlas freído.
Siéntee a ver el partido comiendo las hamburguesas a la mierda sin que nadie moleste, chupándose de mientras un caballito blanco. No se queme por los milicos, porque como hay partido, para no moverse de en frente a ala tele no van a ir a su casa por más que los vecinos denuncien que mató a sus hijos.
¡Hasta la próxima semana! Y... ¡Vamo arriba uruguay no má!

dOCtOR dULCeS sUEÑOS CAP. VIII



Imagen: Bleeding Roses, de Salvador Dalí


Rosa Intestinal


Caminamos hasta una piedra. Isaac orinó de espaldas un chorro inacabable, mientras la niña se mantenía en un silencio sepulcral con la cabeza baja.
Pronto, al costado del cuerpo de Isaac apareció una puerta de color celeste claro. Éste la abrió, haciéndome un gesto de que entráramos, cosa que hicimos, con la niña siguiéndonos con la cabeza baja. Nos metimos en una habitación rectangular de unos diez metros cuadrados. De unas pilas informes en el suelo comenzamos a tomar tanta comida, botellas de agua y frascos de pastillas como pudimos.
-Sólo podemos estar un minuto, luego la puerta se cierra y nunca se encontró a alguien que quedara adentro.
Salimos y a los instantes la puerta desapareció. Nos subimos a la piedra y comencé a comer y tomar agua con pastillas anti-cáncer como desesperado, Isaac me imitó y ordenó a la niña a que también lo hiciera.
-Comé y tomá las pastillas para el cáncer con el agua. No voy a volver a tocarte hasta que estés sin cáncer y limpia, concha jedionda.
Cuando la miré, vi que sin que me percatara antes, se había vuelto una mujer algo aniñada o por lo menos una adolescente, similar a la que era en sus sueños, pero más linda, además de que estaba desnuda.
Luego, Isaac se dirigió a mí:
-Gracias. Sin vos no podría haber logrado nada y seguiría vagando en el desierto. ¡Gracias! –me dijo palmeándome.- Yo ya encontré la perla rosada, pero quizás la puerta negra no se abrió porque es mi destino ayudarte con algo…
- Quizás… -dije, pensando en que en realidad, con el secreto de las puertas invisibles podía zafarme para siempre del Doctor Dulces Sueños y volverme un ser del desierto; libre. Sin embargo, me callé por instinto, mientras escuchaba historias que Isaac pronunciaba y yo no retenía, ocupado en pensar y comer.
- Si se vuelve a abrir la puerta negra, quizás consiga que esta vez el Doctor Dulces Sueños me deje volver del todo –cambió el tema abruptamente.
- ¿Volver a dónde? –pregunté, ahora curioso de lo que pudiera tener que ver con el odioso que se negaba si quiera a verme.
- Al mundo real. Yo no elegí quedarme aquí, si no que un día, simplemente no pude despertar y cuando tomo las pastillas que me da el Doctor Dulces Sueños duermo en este mundo pero no despierto en el otro…
- ¿Qué? ¿Qué otro mundo? ¿Despertarte de qué? –comencé a desesperarme, pero ahora fue Isaac quien se asombró.
- ¿Ustedes no saben que están soñando ahora?
La niña y yo no contestamos por unos momentos, pero luego yo lo hice.
- En realidad soñamos dormidos, cuando tomamos las pastillas y por lo que dicen los médicos lo hacemos siempre, aunque no lo recordemos. Ahora de hecho estamos despiertos.
Isaac seguía mirándonos con incredulidad y nosotros sorprendiéndonos ante cada nueva incoherencia que decía. El diálogo se tornaba cada vez más y más lento.
- No, no. Están confundidos muchachos –se rió nervioso-. Toda su ciudad está formada por cuerpos oníricos, cuando ustedes viven acá es porque sus cuerpos reales están dormidos en el mundo real y cuando duermen acá, lo que según ustedes “sueñan” es la vida real…
- ¡La vida real! –no pude evitar reírme nerviosamente como él- En la vida real no pasan cosas irracionales como las leyes físicas y la moral y todas las cosas lentas, rígidas y lineales que… ¡que sólo pasan en los sueños! Esto no es el sueño, es la vida real…
- ¡No lo puedo creer! Yo soy de los pocos mortales que pueden vivir concientemente en el mundo de los sueños, decidí quedarme en éste porque era sacerdote del Doctor Dulces Sueños, pero pensé que ustedes sí sabían que no eran reales… El Doctor Dulces Sueños y todos ahí adentro lo saben…
Resignado, yo dejé que él siguiera hablando y temiendo por encontrarme al lado de ese loco.
- En realidad yo soy un cuerpo onírico creado por mi mismo o alguien que me conoce, o quizás ni me conoce, pero conservo mi conciencia de cuerpo real consciente aquí y ustedes también son cuerpos oníricos creados en el sueño de una sola noche, que permanecen con independencia de que se les sueñe o no. En realidad son partes de sueños… ¿comprenden? Hay miles como vos en distintos mundos, dependiendo de cuantas veces se te haya soñado y dentro de que mundo, quizás vuelvan a soñar con vos alguna vez o quizás no, pero cuando quien te soñó despierta, o cuando despierta la persona de la cual se formó tu imagen onírica, vos siempre volvés a ser parte de él y le llamás a eso un sueño cuando volvés a ser sólo un ser onírico… ¿Qué… ¿Qué pasa acá? Dentro del Palacio del Sueño todos lo saben…
-¿Bueno y si estás soñando por qué no despertás nunca? Cuando yo tomaba las pastillas según vos despertaba, aunque para mí dormía.
-Yo estoy en un aprieto porque caí bajo las leyes del mundo de los sueños y estoy atrapado por un ser muy poderoso en este mundo, que es el Doctor Dulces Sueños… Es un cuerpo onírico muy, muy poderoso y él simplemente logra que yo duerma en este mundo pero no despierte en el otro, así que lo único que puedo intentar es servirlo hasta que se digne a mostrarme la puerta de marfil. Por allí es por el único lugar por el que un onironauta como yo puede volver al mundo real después de haberse instalado en un mundo onírico. Yo cometí la estupidez de practicar la magia onírica sin haber aprendido aún a encontrar la puerta de marfil por mí mismo…
Ya poco interesado en lo que dijera Isaac, dejé que siguiera hablando como un loco y tomé el frasco de pastillas que había logrado sacar de la puerta celeste, entonces, el me tomó la mano evitando que lo abriera.
- ¡Espera! En el desierto debemos dormir por turnos, es la única manera de poder vigilarnos unos a otros de no morir comidos por criatura o sepultados en arena.
-¡Yo ya dormí! –dijo la niña solícita, como cediendo su turno a Isaac.
- Entonces debemos dejarlo a la suerte entre nosotros dos. –dijo mirándome.
No me gustó el perfil de autoridad que el demente de Isaac estaba comenzando a tener, menos con la complicidad sumisa de la asquerosa niña, adolescente o lo que fuera. Sin embargo, debía someterme a su voluntad cuanto pudiera, porque él era por lejos el más fuerte de los tres.
- Perla rosada –le dijo a la niña, alcanzándole una pastilla-, escondé esto en una de tus manos, el que adivine dónde está duerme.
Por lejos, el método era el más patético que se pudiera imaginar, pero la niña hizo lo que se le mandó y obviamente le dio a elegir primero a Isaac, que, obviamente, encontró la pastilla.
Isaac se acostó tranquilamente en el suelo y se durmió, mientras la niña-mujer lo abrazaba y lo miraba dormir arrobada. Entonces, comencé a tomar comida, agua y pastillas y meterlas en un pedazo de trapo que desgarré de mi ropa ya de por sí desgarrada, con la intención de irme de ahí lo más rápido posible y vivir en el desierto para siempre. Las puertas invisibles me alcanzaban para burlar al Doctor Dulces Sueños el resto de mi existencia, en vez de arrodillarme ante él, creyendo mientras que se trata de un sueño, como hacía Isaac.
Sin embargo, antes de irme miré hacia atrás y no pude creer lo que veía. Ella le había levantado la túnica mientras lamía su pene y en su estómago, se podía ver claramente un tatuaje. Este no era nada más y nada menos que una enorme rosa roja, que parecía sobresalir de la carne, cobrar volumen y sangrar con pétalos hechos como de vísceras, o mejor dicho de intestinos. Una perfecta Rosa Intestinal.
Al mismo tiempo -como una señal que me hizo sentir que realmente el Doctor Dulces Sueños estaba detrás, observándonos invisiblemente y riéndose-, vi aparecer en el aire una puerta negra que flotaba a unos centímetros de la arena.
Sin pensar por qué, solté todo lo que tenía en las manos, menos un frasco de pastillas y salté sobre ellos. Golpeé a la cosa y la saqué de encima de la Rosa Intestinal de un manotazo, tirándola de sobre la piedra hacia la arena. Luego, haciendo un esfuerzo para el cual no tenía energía, me cargué a la espalda a la Isaac, como una bolsa de papas. A los tropezones, corrí hasta la puerta, abriéndola de un empujón. La tipa ya se había levantado y se había arrojado a mis espaldas, golpeándome primero y luego, clavándome las uñas alrededor del cuello y tironeándome para atrás. Soportando el dolor y sin soltar a la Rosa Intestinal, arrojé como pude el cuerpo de Isaac dentro de la puerta, aunque quedó con la mitad de las piernas para afuera. Después me di vuelta como pude y esta vez, pegándole muy, muy fuerte a la que había sido niña, la subí a mis brazos, la remonté por el aire y la tiré para adentro de la puerta también. Luego empujándolos, entré yo también y cerré la hoja que nos separaba del desierto.
Una vez adentro, si bien la entrada había sido horizontal, nos encontramos con que la puerta era el piso de una especie de cloaca vertical de unos tres metros de altura, sobre la cual había una rejilla que dejaba pasar luz de antorchas. Volviendo a golpearla antes de que ella me arañara de nuevo, metí en la boca de la niña una pastilla dejándola dormida junto a la Rosa Intestinal. Yo me quedé esperando que alguien nos sacara de ahí. Yo seguía sin dormir.

domingo, 20 de junio de 2010

EL VIAJE HACIA EL BAR CAPÍTULO VII



Imagen tomada de "La gallina degollada" de Breccia, sobre un texto de H. Quiroga.


UN EXTRAÑO TREN SE LLEVA A UN AMIGO


Así, un nuevo día comenzó y como siempre, los rayos del sol en el medio del cielo despertaron a nuestros amigos, que poco a poco, se daban cuenta que en su pueblo no hacía tanto calor como creían, ya que cuanto más se alejaban de él, más les embargaba éste. Por la falta de costumbre, apenas podían soportar la temperatura y cada vez les costaba más seguir su marcha. Se encontraban ahora, además de famélicos, bajo los efectos perjudiciales que siguen a una noche de estados alterados de conciencia. Tenían los ojos pequeños y pegoteados, dolor de cabeza y sentían un gran malestar físico en general.
Sin embargo, Bernardo se sentía feliz de haber visto -aunque sea- un adelanto de lo que se vivía en el pueblo del alcohol y atravesaba dichos malestares como una hermosa instancia de crecimiento.
Ambos comenzaron a caminar, despojados como estaban de sus vehículos, por su falta de prudencia con los desconocidos. Al principio no emitían palabras por el cansancio, pero todo estalló cuando Bernardo (sin malas intenciones), preguntó a su amigo Damián cuánto quedaba para llegar a su destino.
Este, ostensiblemente molesto, demoró unos segundos en contestar, mirando con ira a su amigo, sobre todo, porque veía que este sobrellevaba casi con felicidad su atroz resaca, mientras él, desesperaba por una bala que lo reconfortara y alejara el dolor.
- No sé. –contestó finalmente.
Siguieron caminando callados y Bernardo, pensaba en cómo plantear sus pensamientos a su amigo, sin que este se enfadara aún más con él.
- Entonces ¿Cómo haremos para llegar? ¿Otra vez no sabes ni a dónde vamos?
Fue así que comenzó el fin de esta entrañable amistad.
Damián, muy enojado, le contestó que no le importaba ni sabía, ya que sólo estaba preocupado en ese momento porque no tenía balas y eso, le importaba mucho más que ese tonto viaje, que no se le había ocurrido a él si no a él. A su vez, Bernardo le dijo que sí, que se había dado cuenta de que lo único que le importaba a él, en ese momento y siempre eran las balas de m… y que el viaje se le había ocurrido a él, pero nadie le había puesto una gomera en la cabeza a él para que se decidiera a acompañarlo y que además, el que había perdido el mapa, la plata, el triciclo y el buggy, había sido él y no él. Él a su vez, le dijo que él era un m… de m… y que él, no tenía miedo a morirse de falta de lactosa, pero claro, él estaba enojado porque alguien quisiera una bala, como si él no hubiera hecho que por lo menos salieran del pueblo, porque él, si no tenía un mapa no sabía ir ni hasta la esquina y él, le dijo que no era cierto.
Cuando él estaba por levantar la voz, para decirle a él que tenía la culpa él y no él, un extraño ruido detrás los cortó en seco.
Y ahora no creeréis lo que ellos vieron y no os culpo, yo tampoco lo creería. Allí, caminando con paso firme para darles alcance, vieron una figura casi de un indigente. Las ropas estaban hechas jirones y manchadas de sangre, había rasguños por todo su cuerpo, algunos eran largas cicatrices que le daban un aspecto de indio bandolero y su forma de andar estaba un poco renga. Les costó reconocerlo, pero sí, al verlo un poco más cerca lo reconocieron: era el sheriff, increíblemente vivo, luego de una atroz lucha con el tigre albino y completamente abocado solamente a darles caza, como forma de vengarse de la paliza felina que había recibido por la culpa de nuestros amigos; según pensaba él.
Cómo había podido sobrevivir o preguntarle esto mismo fue una posibilidad que cruzó la cabeza de los rapaces, sin embargo, como sabían que de apresarlos la pasarían mal y que ante todo, debían completar su itinerario si querían llegar a poner pie en la tierra de sus deseos (que tantos sinsabores les estaba costando), debían huir de dicho representante de la ley, el orden y el progreso, decidieron alejarse rápidamente.
Como ya se habían acostumbrado, comenzaron a correr para alejarse de su seguro captor, que si bien estaba malherido, no andaba tan despacio, mientras ellos, cansados y abatidos, estaban bastante torpes en su huída.
No obstante, ni bien la persecución comenzó, al dar vuelta apenas la cabeza, Bernardo apreció que el sheriff sacaba del destrozado chaleco una coquitera (seguramente extraída del cuerpo ya sin vida de uno de los viejos muy eruditos y poco amistosos) y la tensaba, con el fin de disparar sendos proyectiles hacia sus desgraciadas cabecitas.
Uno de dichos proyectiles fue disparado y ni bien sintieron el chasquido de la gomita de la coquitera, ambos fugitivos intentaron evadirlo, pero el mismo rozó muy de cerca la pierna de Damián. El segundo coquito disparado alcanzó a este en un brazo. Él herido hizo “Ssss” y aunque le dolía siguió corriendo, mientras ambos miraban hacia atrás previendo un fatal desenlace.
- ¡Por favor! –gimió Bernardo, poniendo voz de bueno y sabiendo que en el pueblo lo querían más- Sólo somos dos jóvenes en busca de aventuras ¿No querrá una persona tan noble como Vd. devolvernos cadáveres a nuestras afligidas madres?
El sheriff -que tampoco era tan malo como aparentaba-, conmovido, dudó en su carrera y bajó la coquitera. Sin embargo, tras un momento de reflexión, volvió a endurecer sus facciones y levantando su arma, gritó:
-¡No cabemos en el mismo pueblo! –lo cual es totalmente comprensible, ya que Bernardo pronunció su apelación a la clemencia con signos de interrogación, siendo sabido que a nivel de las funciones pragmáticas del lenguaje, siempre es mejor afirmar implícitamente que preguntar, habiendo sido totalmente eficaz que Bernardo enunciara: “¡No querrá una persona tan noble como Vd. devolvernos cadáveres a nuestras afligidas madres!”, si bien es cierto que en situaciones que requieren de mayor uso de cortesía y consideración, es más efectivo indicar preguntando (por ej: “¿Me da fuego?”). De la misma manera, si bien el contenido semántico del enunciado del sheriff se comprende dentro de la situación, podría ser desambigüizado por medio del uso del lenguaje recto, ya que el discurso figurado “no cabemos en el mismo pueblo” (metáfora, mas también hiperbole), podría ser no comprendido por alguien poco avisado y ducho en la paráfrasis exhaustiva, ya que en ese momento ninguno de los tres se encontraba en ningún pueblo, por lo que no exisitiría un conflicto justificado hasta que Damián y Bernardo convivieran con el sheriff en un mismo poblado (considérese igual la posición de aquellos que raltivizan la separación entre sentido recto y figurado del lenguaje).
Renovado en sus ímpetus, el señor sheriff comenzó entonces a descargar una verdadera tormenta apocalíptica de coquitos sobre los dos amigos. Estos, corrían desesperadamente tratando de evitar los disparos, pero de cada tres o cuatro que lanzaba el sheriff, alguno les pegaba y les dolía mucho.
Sin embargo, utilizando más maña que fuerza, Bernardo exclamó:
- ¡Mira Damián, si bajamos esa pendiente por ahí hay una vía de tren, donde nos será más fácil huir raudamente de nuestro captor!
-¡Vamos entonces! –contestó rápidamente y sin dudarlo su interlocutor, mientras un coquito pasaba muy peligrosamente por el costado de su ojo.
Como dos ráfagas de viento, bajaron la empinada pendiente, llegando al terreno liso de las vías de tren y a su vez, evitando algo del flagelo de los coquitos que (dado el cumplimiento regular de ciertas leyes ya mencionadas en esta historia) al descender, perdían aceleración y por lo tanto, fuerza de impacto.
Segundos después de que nuestros amiguitos llegaran al terreno llano, sin embargo, el sheriff -que no cejaba en su empeño de capturarlos- también ganó la llanura con su andar renqueante y preparó nuevamente su coquitera. Nuestros personajes creyeron entonces que la persecución no tendría fin y que, por más que resistieran, sólo lograrían aplazar el momento en que los apresaran, arriesgándose incluso a ser muertos a coquitazos.
Bernardo entonces, decidió que lo mejor sería entregarse y ya procedía a decírselo a su amigo.
Pero justo en ese instante, pasó algo inaudito.
Ni bien Bernardo y Damián sacaban sus pies de las anchas vías, el sheriff procedía a posarlos en ellas, cuando una tromba infernal los sorprendió, a la vez que sentían algo como un chasquido de huesos a sus espaldas.
Al darse vuelta para observar, anonadados, vieron una larga carreta de metal negro y herrumbrado, que largaba humo como Damián al fumar sus balas y que siguió pasando por varios segundos a una velocidad increíble. Bernardo, maravillado se preguntaba cuántos minutos demoraría un vehículo así en llegar al país del alcohol. Damián ensanchó terriblemente sus ojos.
Este último cayó de rodillas y comenzó a sollozar, mientras Bernardo lo miraba sin comprender.
- ¿Qué pasa? –preguntó Bernardo.
Sin embargo, con el ruido del tren, Damián no lo escuchó y respondió para si mismo:
- ¡El tren bala! ¡Al fin voy a tener una bala en mis manos de nuevo!
Sin oírse entre sí, ambos vieron al tren frenar lentamente unos metros más delante de ellos.
Cuando las ruedas del mismo despejaron la vía, vieron sobre la misma al sheriff, que ahora presentaba un aspecto espantoso y heridas de las que no se repondría tan fácilmente como al ser atacado por el tigre albino. El pobre sheriff era ahora una estirada mancha roja y viscosa que despedía un desagradable olor y algo de vapor, de la que sobresalían pedacitos de carne picada y huesos astillados, más alguna que otra víscera, de las cuales la mayoría se habían enroscado en las ruedas del tren.
Los muchachos no habían podido si quiera aún asumir la muerte de su amigo, cuando del último vagón surgió un chirrido quejumbroso y vieron abrirse la puerta.
Lentamente, pero de manera constante, comenzaron a asomar miembros cubiertos de ropas raídas en su mayoría, tardando en aparecer los cuerpos a los que pertenecían. Los miembros se apelotonaban en la puerta, sin espacio para bajar, a la vez que de la puerta abierta comenzaba a emanar un olor nauseabundo y grotescos ululares y sonidos que remotamente se parecían al habla articulada de un humano normal.
Nuestros héroes observaron el forcejeo con la boca abierta, hasta que al fin, un amasijo de cuerpos cayó precipitadamente al suelo. Los seres caídos demoraban enormemente en reincorporarse y los balidos subían cada vez más su intensidad, al tiempo que un jorobado, enano, brazicorto y con la cara llena de cicatrices y suturas, aullaba por imitación con su boca desdentada, a punto de caer mientras se aferraba a la hoja de la puerta.
Sin dar tiempo a los caídos de levantarse, una nueva ola de cuerpos comenzó a bajar torpe y atropelladamente del tren, pisoteando a sus compañeros en el suelo y tirando insensiblemente al jorobado para pasar.
Bernardo y Damián contemplaron que el jorobado no era el único ser singular sobre el extraño vehículo. Como un desfile de fenómenos, apelotonados y emitiendo gañidos desagradables, bajaban uno tras otro una serie de deformes, mutilados, mutantes, siameses, inválidos en su más grande variación, seres que apenas se podrían llamar antropomórficos, todos ellos emitiendo extraños sonidos sombríos e incomprensibles y la mayoría con la ropa manchada de orines, materias fecales, baba aglutinada y otros fluidos corporales.
Bernardo, como ante una visión de esas que ilustraban el infierno en la Biblia del Reverendo, comenzó a sentir miedo, se acurrucó contra Damián y preguntó casi llorando:
-¿Qué son esos monstruos?
Pero Damián, enceguecido o algo por el estilo, temblando y con los ojos brillantes repetía una y otra vez la misma frase, como los deformes sus sonidos guturales:
-¡Balas! ¡Balas! ¡Balaaaaaaaaaaas!
Bernardo trató de detener a su amigo, pero éste ya iba casi corriendo hacia el pelotón de inválidos. Luego comenzó a gritarles, tirar de su ropa y hasta arrodillarse tratando de llamarles la atención, pero estos como autómatas, seguían bajando como cucarachas moribundas del tren y apelotonándose en algo parecido a unas filas paralelas entre sí, al lado de la vía. Bernardo gritaba a su amigo que volviera, sin embargo, éste, preso de la locura, se hincó de rodillas ante una mujer sin los brazos y con tres piernas, cuyos ojos estaban desorbitados como los de los enfermos de hipertiroidismo y tenía la boca cosida y le decía llorando:
-¡Balas! ¡Ustedes tienen balas! ¡Es el tren bala!
Pero la mujer, siguió su camino como hipnotizada, pisoteando a Damián, que sin resignarse se aferró de las rodillas de un siamés con una cabeza más chica que la otra y le imploró:
- ¡Déme una bala!
Pero los deformes seguían avanzando como ciegos (unos cuantos lo eran).
Bernardo quiso dar un paso atrás y huir de aquel tenebroso panorama. Pero ni bien movió el pie se detuvo, ya que sintió bajo sus pies la viscosidad liquida que había sido alguna vez el sheriff. Además no quería abandonar a su amigo (si bien habían discutido) en una situación tan peligrosa. No obstante ello, lo que más lo detenía como pegado al lugar donde se hallaba parado e inmóvil, era una extraña y contradictoria fascinación por la pesadilla que veía desarrollarse frente a él.
Ahora, las vías del tren eran bordeadas por unas docenas de inválidos y deformes alineados en tres filas una detrás de la otra, frente a las cuales se había parado un hombre con, los dedos palmeados y algo achaparrado vestido con una chistera y un frac, tal como un director frente a su coro. Y lo más espeluznante de todo, era que realmente era el director de un coro y los inválidos este último.
Luego de unos momentos de preparación, en que los deformes dejaron de ulular y el director alineó su ropa y levantó la batuta, las bocas monstruosas comenzaron a entonar una atroz disonancia a destiempo y con voces gangosas, ultra agudas, roncas -y a veces hasta chistosas- una salmodia incomprensible.
Los primeros tiempos parecían algo de película de terror, pero con el paso de la repetición de los dos únicos versos que constituían la pieza (siempre en el mismo ritmo y compás, sin variar un tono y al tiempo sin lograr nada parecido a la armonía), Bernardo comenzó a entender que cantaban algo, aunque sólo pareciera que gruñeran.
Le costó entender lo que pronunciaban, pero sin embargo, le costó más entender el sentido de repetir tantas veces tal vacuedad:


“Así baila Fernandito,
Fernandito baila así.
Así baila Fernandito,
Fernandito baila así,
Así baila Fernandito
Etc.. etc…etc..”


Dadas las deformidades y taras de cada uno de los ejecutantes, era muy difícil llegar a decodificar la letanía, ya que algunos decían: “Achí bala Penandito”, mientras otros no lograban modular otras letras, habiendo variaciones de todo tipo como “Atí baila Fenandito”, “Azí pala Penandito”, Etc. Etc. Etc.
Pero lo más escabroso, no era solamente las incapacidades lingüísticas de los seres bizarros que las emitían, sino el sentido de tal disparatada e incongruente proposición, además de que ni Bernardo ni Damián, ni el sheriff podían saber de qué Fernandito se estaba hablando, como tampoco (y menos que nadie), vuestro humilde narrador.
La pieza parecía no terminar más. No había intervalos ni variaciones, sólo el repetitivo “Así baila Fernandito/ Fernandito baila así”, que parecía no acabarse jamás, mientras Bernardo miraba incapaz de reaccionar y Damián trataba de gritar -por arriba del coro y tirando de las ropas de los coristas indiferentes- si alguno le daba una bala.
Después de unos cuantos compases, la escena se volvió aún más macabra, cuando los inválidos, rengueando unos, haciendo movimientos compulsivos y espásticos otros, babeando la mayoría y otros haciendo cosas inenarrables y contrarias a la anatomía, comenzaron a imitar un paso de baile que, seguramente, ilustraba el de Fernandito, al tiempo que sin dejar de cantar, se comenzaban a dirigir de nuevo hacia el vagón, como un éxodo de teatro griego.
Bernardo, sin poder creerlo, vio que su amigo Damián, como un deforme más, comenzó a seguir a la procesión y se notaba su clara intención de subir con ellos. Entonces, el muchacho comenzó a correr, para tratar de convencer a Damián de que no hiciera tal locura, pero la montonera de inválidos insensibles (que no abrían paso, ni se daban cuenta de que un cuerpo se interponía en su camino), le impidió llegar a tiempo.
-¡No lo hagas! ¡No lo hagas Damián! –gritó Bernardo con todas sus fuerzas, pero su amigo, apenas se dio vuelta para mirarlo, en ese mismo momento en que ya definitivamente el coro comenzaba a subir al tren sin dejar de cantar, en primer lugar el director y luego, todos los inválidos, sacaron unas enormes balas marrones y largas de sus ropas y comenzaron a aspirarlas de una forma grotesca y babeante, por los costados de bocas a veces no demasiado apropiadas a tal fin; de la misma manera que algunos, se metían las balas en las orejas, la nariz e incluso en algunos orificios menos anatómicamente apropiados.
Damián, con los ojos llorosos de júbilo, gritaba “¡Yo sabía, yo sabía! Era el tren bala!”, al tiempo que se dejaba arrastrar por la marea dentro del tren, Bernardo no pudo llegar a tiempo. La puerta del vagón se cerró y la ventanilla sucia sólo le dejaba ver un amasijo de seres temblequeantes, que seguían cantando cada vez más alto “Así baila Fernandito,/ Fernandito baila así”.
Bernardo intentó golpear la puerta del vehículo, pero era imposible que lo escucharan de adentro.
Pronto, de una forma ensordecedora, el tren comenzó a pitar, acompañando los graznidos del coro y locomotora comenzó a moverse.
Bernardo comenzó a intentar correr tras el enorme tren, pero como sabréis, es inútil que un ser humano intente si quiera llegar a recorrer la misma distancia en velocidad de un ferrocarril, por lo cual sus intentos fueron infructuosos y pronto, el vagón fue sólo una mancha lejana sobre las vías del tren.
Bernardo, se sentó exhausto a llorar sobre las vías. La última imagen que le había quedado de su amigo, era verlo seguir como un deforme más a una manada de deformes, clamando por una bala
Ahora, estaba perdido, no sabía como llegar a la tierra de sus sueños y el extraño tren se había llevado a dos de los compañeros de su travesía.

dOCtOR dULCeS sUEÑOS CAP. VII



Imagen: Egon Schiele


Perla rosada


Cuando los soles comenzaron a castigarnos, la niña seguía durmiendo. El desconocido, que ya parecía poder hablar me dijo:
- Sería mejor que empezáramos a caminar.
Yo cargué a la niña sobre los hombros, mientras sentía como sus cánceres me raspaban la espalda. Al iniciar nuestra caminata, no hablamos de nada, pero luego, yo no pude evitar mirar al otro involuntariamente, quizás por lo cansado que estaba de ver sólo desierto. Entonces, note que su vestimenta desteñida y hecha jirones, de seguro había sido una de las túnicas anaranjadas que se usaban dentro del Palacio del Sueño. Sin embargo no me atrevía a preguntar sobre eso, pero él comenzó a contestar cosas solo:
- Me llamo Isaac y anoche estaba a punto de morir, ya que me salvaste a vida, tengo que confiártelo todo, así que podés preguntar.
Yo iba a preguntar, pero estaba pensando en si realmente yo podía confiar en que él me confiaría todo, cuando continuó contestando solo:
- El problema es que el Doctor Dulces Sueños me mandó al desierto a encontrar la perla rosada y hasta que no lo haga, no podré abrir las puertas invisibles, por lo que estoy hace días sin comer, tomar agua o tomar pastillas para dormir o contra el cáncer solar. Estaba por morir…
Sin darme cuenta pregunté con desesperación:
- ¿Qué puertas invisibles?
Isaac, quedó como decepcionado un momento.
-Es que quisiera mostrártelas ahora para que entiendas más rápido, pero hasta que no encuentre la perla rosada no puedo. –hizo una pausa y se detuvo- Es un secreto de profesión, pero prometí decirte todo y mi honor está primero. En el desierto, la única forma de sobrevivir es conocer las puertas invisibles. El desierto todas las noches se repliega y da vueltas sobre si mismo como un gusano, por lo que el que entra no puede salir de él si no es por la puerta negra del Doctor dulces Sueños, que se abre cuando él quiere. Entonces, la única forma de no morir antes de que puedas cruzar nuevamente la puerta negra, es entrar cada tanto a las puertas invisibles. Se vuelven visibles en el aire del desierto cuando orinás de espaldas a alguna de las piedras. Hay varias, de varios colores y cambian de lugar siempre, dentro hay agua, comida, pastillas. Sin embargo, hace días que estoy en el desierto y no puedo usarlas. Me salvaste la vida con lo que fuera que me diste para comer.
Continué caminando anonadado, pensando en la salvación que no podríamos utilizar. Yo no podía orinar ya que no dormía hace meses, al igual que Isaac, por lo que la única que nos podía salvar era la niña, si es que tenía el suficiente líquido dentro como para orinar algo.
Sin explicar nada, la tiré al suelo y le dije a Isaac.
-¡Hay que despertarla!
-¿No es una muñeca? –preguntó él, realmente confundido.
Pero yo ya estaba sacudiéndola y gritándole en el oído que se despertara. Pronto, Isaac entendió y me detuvo.
- No es así. –dijo apartándome. Y comenzó a golpear brutalmente a la niña hasta en los cánceres, que reventaban y largaban una sustancia violeta. Luego comenzamos a golpearla y gritarle ambos, pero estaba profundamente dormida y yo le pedí a Isaac que se detuviera para no matarla, perdiendo entonces nuestra única esperanza.
Nos quedamos sentados y repartimos lo que quedaba de músico muerto, cuando me di cuenta de lo que había olvidado.
- ¡La niña tiene pastillas de dormir escondidas en las bombachas!- grité.
Al segundo, estábamos levantándole el vestido y sacándole las diminutas bombachas de algodón finito con flores estampadas, pero no encontramos las pastillas.
- No puede ser, yo mismo vi como las sacó de ahí ayer y sé que tenía más de dos…
Isaac, que parecía saber mucho más que yo de todo, me apartó, diciéndome:
-No las sacó de sus bombachas.
Rápido, metió dos dedos dentro de la vagina de la niña y empezó a revolvérsela como un monedero, mientras con dos dedos de la otra mano, hacia lo mismo con su orificio anal.
-Creo que acá hay algo. –dijo, mientras retirando los dedos de dentro de la vagina, separó los labios de la vulva, mirando con atención. Lo que había allí, no era una pastilla, si no algo como un bochón de un rosado fuerte y superficie cristalina. Isaac lo tomó en sus dedos palpando su textura y dureza, al tiempo que gritó con júbilo:
-¡Es la perla rosada!
Él no reparó en que de forma automática, ni bien tocó la perla, la niña despertó, gimiendo enloquecida:
-¡Ah! ¡Si me hacés un buen oral te doy una pastilla!
Sin comprender que necesidad tenía Isaac de que la niña le diera una pastilla, ahora que podía usar las puertas invisibles, lo vi bajar como un perro a la entrepierna de la niña y comenzar a lamérsela con una larguísima lengua como de serpiente. Comencé a sentir asco de lo que veía, pero no podía evitar mirar. No obstante la relación entre Isaac y la niña casi no duró y todo fue peor para mí, ya que ni bien el vio que ella se entregara totalmente al placer y estuviera indefensa, sacando un cuchillo de algún lado, le rebanó la perla, extirpándola de su entrepierna, entre aullidos de dolor y un mar de sangre.
Isaac se incorporó escupiendo y pasándose la mano por la boca y la lengua. Luego, limpió de sangre la perla y su propia mano con su ropaje hecho pedazos y la aferró sonriendo.
-¡Dame la pastilla que me prometiste! –dijo autoritariamente a la niña, mientras se acercaba a ella.
La niña, llorando aún, pero ahora, como si se sintiera culpable en vez de dolorida, se levantó inmediatamente y vino hacia mí. Yo pensé que reclamando protección, pero antes de que yo la abrazara instintivamente, ella me metió las manos dentro del pantalón, después dentro de mis calzoncillos y sacó unas cinco pastillas.
-Son todas las que tengo… -le dijo sumisamente y lloriqueando, mientras se las daba en la mano.
Sin contestarle, Isaac comenzó a caminar.
-Seguime –me dijo, acompañándose con un gesto.